RchiOBHm_Chr4g0423481

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
49114949 .. 49115436
488 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ39284

Sequence Viewer

Length: 192 bp
ATGGGAAATACTCAAGCACCTCCGACACGGCCTCAACCAAGGAATACTATTACTCCTCCTAACTACCCTTGTCCAGGAGCACCGAAGAAGCAGCCCATCAACTCTGACGAGGCAGCGCGACGCTACGGTGGGATTGTCATTACTGAATATGGTACTACTACGAATAATCCCACCGTCAATAGGCGTTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

6.86

Weight (kDa)

10.17

Isoelectric Point (pI)

55.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 118
AfaI GTAC 1 cut(s) 154
AfiI CCNNNNNNNGG 2 cut(s) 74, 180
AjnI CCWGG 1 cut(s) 73
Alw21I GWGCWC 1 cut(s) 82
AoxI GGCC 1 cut(s) 29
ApeKI GCWGC 2 cut(s) 91, 113
AspLEI GCGC 1 cut(s) 118
Bbv12I GWGCWC 1 cut(s) 82
BbvI GCAGC 2 cut(s) 103, 125
BccI CCATC 1 cut(s) 104
BceAI ACGGC 1 cut(s) 44
BciT130I CCWGG 1 cut(s) 75
BisI GCNGC 2 cut(s) 92, 114
BlsI GCNGC 2 cut(s) 93, 115
Bme1390I CCNGG 1 cut(s) 75
BmrFI CCNGG 1 cut(s) 75
BsaJI CCNNGG 1 cut(s) 38
BsaXI ACNNNNNCTCC 2 cut(s) 37, 67
Bsc4I CCNNNNNNNGG 2 cut(s) 74, 180
BseBI CCWGG 1 cut(s) 75
BseDI CCNNGG 1 cut(s) 38
BseLI CCNNNNNNNGG 2 cut(s) 74, 180
BseRI GAGGAG 1 cut(s) 45
BseXI GCAGC 2 cut(s) 103, 125
Bsh1236I CGCG 1 cut(s) 118
BshFI GGCC 1 cut(s) 31
BsiHKAI GWGCWC 1 cut(s) 82
BslI CCNNNNNNNGG 2 cut(s) 74, 180
BsnI GGCC 1 cut(s) 31
Bsp1286I GDGCHC 1 cut(s) 82
BspANI GGCC 1 cut(s) 31
BspFNI CGCG 1 cut(s) 118
BssECI CCNNGG 1 cut(s) 38
BssT1I CCWWGG 1 cut(s) 38
Bst2UI CCWGG 1 cut(s) 75
Bst4CI ACNGT 2 cut(s) 128, 175
BstENI CCTNNNNNAGG 1 cut(s) 72
BstFNI CGCG 1 cut(s) 118
BstHHI GCGC 1 cut(s) 118
BstNI CCWGG 1 cut(s) 75
BstSCI CCNGG 1 cut(s) 73
BstUI CGCG 1 cut(s) 118
BstV1I GCAGC 2 cut(s) 103, 125
BsuRI GGCC 1 cut(s) 31
CfoI GCGC 1 cut(s) 118
CseI GACGC 1 cut(s) 129
Csp6I GTAC 1 cut(s) 153
CviJI RGCY 2 cut(s) 31, 94
CviKI_1 RGCY 2 cut(s) 31, 94
CviQI GTAC 1 cut(s) 153
Eco130I CCWWGG 1 cut(s) 38
EcoNI CCTNNNNNAGG 1 cut(s) 72
EcoRII CCWGG 1 cut(s) 73
EcoT14I CCWWGG 1 cut(s) 38
ErhI CCWWGG 1 cut(s) 38
FaiI YATR 1 cut(s) 150
Fnu4HI GCNGC 2 cut(s) 92, 114
Fsp4HI GCNGC 2 cut(s) 92, 114
GlaI GCGC 1 cut(s) 117
GluI GCNGC 2 cut(s) 92, 114
HaeIII GGCC 1 cut(s) 31
HgaI GACGC 1 cut(s) 129
HhaI GCGC 1 cut(s) 118
Hin6I GCGC 1 cut(s) 116
HinP1I GCGC 1 cut(s) 116
Hpy188I TCNGA 2 cut(s) 24, 106
Hpy99I CGWCG 1 cut(s) 123
HpyCH4III ACNGT 2 cut(s) 128, 175
HspAI GCGC 1 cut(s) 116
LmnI GCTCC 1 cut(s) 77
LpnPI CCDG 2 cut(s) 60, 87
Lsp1109I GCAGC 2 cut(s) 103, 125
MboII GAAGA 1 cut(s) 97
MhlI GDGCHC 1 cut(s) 82
MmeI TCCRAC 1 cut(s) 47
MnlI CCTC 4 cut(s) 30, 42, 66, 103
MseI TTAA 1 cut(s) 190
MspR9I CCNGG 1 cut(s) 75
MvaI CCWGG 1 cut(s) 75
MvnI CGCG 1 cut(s) 118
PfoI TCCNGGA 1 cut(s) 73
PkrI GCNGC 2 cut(s) 93, 115
Psp6I CCWGG 1 cut(s) 73
PspGI CCWGG 1 cut(s) 73
RsaI GTAC 1 cut(s) 154
RsaNI GTAC 1 cut(s) 153
SaqAI TTAA 1 cut(s) 190
SatI GCNGC 2 cut(s) 92, 114
ScrFI CCNGG 1 cut(s) 75
SduI GDGCHC 1 cut(s) 82
SetI ASST 1 cut(s) 22
SgeI CNNG 8 cut(s) 26, 39, 51, 81, 86, 87, 121, 129
SmlI CTYRAG 1 cut(s) 12
SmoI CTYRAG 1 cut(s) 12
StyD4I CCNGG 1 cut(s) 73
StyI CCWWGG 1 cut(s) 38
TaaI ACNGT 2 cut(s) 128, 175
Tru1I TTAA 1 cut(s) 190
Tru9I TTAA 1 cut(s) 190
TseI GCWGC 2 cut(s) 91, 113
XagI CCTNNNNNAGG 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.