Rh4DG247300

LRR receptor-like serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
OG0004342
Physical Location & Seq
Forward (+)
45949798 .. 45950434
637 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG247300.1

Sequence Viewer

Length: 270 bp
ATGGGGAATGTTCAAGTTTCTGTTCCTCCTACACGGCCTCCTCCAAGAACTGTTCCTAATTACACTCGTGGGGGACATGATACCGATCGGCATACATATGCCAACACGAACATGGAGAATCGTGACCAAATTCCAGGAGTAGGAGTGCAGAAGCAAAGACCCGTCATCAACTCTGATGAGGCTGCGCGACGCTACGGTGGGGTAGTCATTACTGAAATATACGGTACTGCTACGAATAAAACTGCGATCACTCGTAATTGGCGTTATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRRNT_2 LRR_1 LRR_6 LRR_8

Protein Analysis

89

Amino Acids

9.98

Weight (kDa)

10.09

Isoelectric Point (pI)

33.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 187
AcsI RAATTY 1 cut(s) 129
AfaI GTAC 1 cut(s) 226
AfiI CCNNNNNNNGG 1 cut(s) 140
AgsI TTSAA 1 cut(s) 14
AjnI CCWGG 1 cut(s) 133
AoxI GGCC 1 cut(s) 35
ApeKI GCWGC 1 cut(s) 182
ApoI RAATTY 1 cut(s) 129
AspLEI GCGC 1 cut(s) 187
BauI CACGAG 1 cut(s) 66
BbvI GCAGC 1 cut(s) 169
BceAI ACGGC 1 cut(s) 50
BciT130I CCWGG 1 cut(s) 135
BisI GCNGC 1 cut(s) 183
BlsI GCNGC 1 cut(s) 184
Bme1390I CCNGG 1 cut(s) 135
BmrFI CCNGG 1 cut(s) 135
BsaBI GATNNNNATC 1 cut(s) 84
BsaXI ACNNNNNCTCC 4 cut(s) 22, 52, 129, 159
Bsc4I CCNNNNNNNGG 1 cut(s) 140
Bse8I GATNNNNATC 1 cut(s) 84
BseBI CCWGG 1 cut(s) 135
BseJI GATNNNNATC 1 cut(s) 84
BseLI CCNNNNNNNGG 1 cut(s) 140
BseRI GAGGAG 1 cut(s) 30
BseXI GCAGC 1 cut(s) 169
BsgI GTGCAG 1 cut(s) 167
Bsh1236I CGCG 1 cut(s) 187
Bsh1285I CGRYCG 1 cut(s) 88
BshFI GGCC 1 cut(s) 37
BsiEI CGRYCG 1 cut(s) 88
BslFI GGGAC 1 cut(s) 87
BslI CCNNNNNNNGG 1 cut(s) 140
BsmFI GGGAC 1 cut(s) 87
BsnI GGCC 1 cut(s) 37
Bsp143I GATC 2 cut(s) 85, 246
BspANI GGCC 1 cut(s) 37
BspFNI CGCG 1 cut(s) 187
BssMI GATC 2 cut(s) 85, 246
BssSI CACGAG 1 cut(s) 66
Bst2BI CACGAG 1 cut(s) 66
Bst2UI CCWGG 1 cut(s) 135
Bst4CI ACNGT 3 cut(s) 52, 197, 224
BstFNI CGCG 1 cut(s) 187
BstHHI GCGC 1 cut(s) 187
BstKTI GATC 2 cut(s) 88, 249
BstMBI GATC 2 cut(s) 85, 246
BstMCI CGRYCG 1 cut(s) 88
BstNI CCWGG 1 cut(s) 135
BstSCI CCNGG 1 cut(s) 133
BstUI CGCG 1 cut(s) 187
BstV1I GCAGC 1 cut(s) 169
BsuRI GGCC 1 cut(s) 37
CfoI GCGC 1 cut(s) 187
CseI GACGC 1 cut(s) 198
Csp6I GTAC 1 cut(s) 225
CviAII CATG 2 cut(s) 77, 112
CviJI RGCY 2 cut(s) 37, 182
CviKI_1 RGCY 2 cut(s) 37, 182
CviQI GTAC 1 cut(s) 225
DpnI GATC 2 cut(s) 87, 248
DpnII GATC 2 cut(s) 85, 246
EcoRII CCWGG 1 cut(s) 133
FaeI CATG 2 cut(s) 80, 115
FaiI YATR 6 cut(s) 78, 93, 97, 99, 113, 220
FaqI GGGAC 1 cut(s) 87
FatI CATG 2 cut(s) 76, 111
FauNDI CATATG 1 cut(s) 97
Fnu4HI GCNGC 1 cut(s) 183
Fsp4HI GCNGC 1 cut(s) 183
GlaI GCGC 1 cut(s) 186
GluI GCNGC 1 cut(s) 183
HaeIII GGCC 1 cut(s) 37
HgaI GACGC 1 cut(s) 198
HhaI GCGC 1 cut(s) 187
Hin1II CATG 2 cut(s) 80, 115
Hin6I GCGC 1 cut(s) 185
HinP1I GCGC 1 cut(s) 185
HinfI GANTC 1 cut(s) 118
Hpy188I TCNGA 1 cut(s) 175
Hpy188III TCNNGA 1 cut(s) 122
Hpy99I CGWCG 1 cut(s) 192
HpyCH4III ACNGT 3 cut(s) 52, 197, 224
HpyCH4V TGCA 1 cut(s) 148
Hsp92II CATG 2 cut(s) 80, 115
HspAI GCGC 1 cut(s) 185
Kzo9I GATC 2 cut(s) 85, 246
LpnPI CCDG 2 cut(s) 120, 147
Lsp1109I GCAGC 1 cut(s) 169
MaeIII GTNAC 1 cut(s) 122
MalI GATC 2 cut(s) 87, 248
MboI GATC 2 cut(s) 85, 246
MluCI AATT 3 cut(s) 58, 129, 256
MnlI CCTC 4 cut(s) 36, 48, 51, 172
MseI TTAA 1 cut(s) 268
MslI CAYNNNNRTG 2 cut(s) 96, 110
MspR9I CCNGG 1 cut(s) 135
MvaI CCWGG 1 cut(s) 135
MvnI CGCG 1 cut(s) 187
NdeI CATATG 1 cut(s) 97
NdeII GATC 2 cut(s) 85, 246
NlaIII CATG 2 cut(s) 80, 115
NmuCI GTSAC 1 cut(s) 122
PcsI WCGNNNNNNNCGW 1 cut(s) 259
PfeI GAWTC 1 cut(s) 118
PfoI TCCNGGA 1 cut(s) 133
PkrI GCNGC 1 cut(s) 184
Ple19I CGATCG 1 cut(s) 88
Psp6I CCWGG 1 cut(s) 133
PspGI CCWGG 1 cut(s) 133
PvuI CGATCG 1 cut(s) 88
RsaI GTAC 1 cut(s) 226
RsaNI GTAC 1 cut(s) 225
RseI CAYNNNNRTG 2 cut(s) 96, 110
SaqAI TTAA 1 cut(s) 268
SatI GCNGC 1 cut(s) 183
Sau3AI GATC 2 cut(s) 85, 246
ScrFI CCNGG 1 cut(s) 135
SmiMI CAYNNNNRTG 2 cut(s) 96, 110
Sse9I AATT 3 cut(s) 58, 129, 256
StyD4I CCNGG 1 cut(s) 133
TaaI ACNGT 3 cut(s) 52, 197, 224
TasI AATT 3 cut(s) 58, 129, 256
TfiI GAWTC 1 cut(s) 118
Tru1I TTAA 1 cut(s) 268
Tru9I TTAA 1 cut(s) 268
TseFI GTSAC 1 cut(s) 122
TseI GCWGC 1 cut(s) 182
Tsp45I GTSAC 1 cut(s) 122
XapI RAATTY 1 cut(s) 129
XcmI CCANNNNNNNNNTGG 1 cut(s) 109
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.