Basic Information

Type: gene

Biological Identity

Species

fragaria_vesca

Chromosome

Fvb5

Orthogroup ID

OG0001455

Physical Location & Seq

Genomic Coordinates Reverse (-)

16892361 .. 16892909

Gene Structure 549 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

FvH4_5g25370.t1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 228 bp

ATGGCCACATCAAAGATTGATTATGTGTTAGTTGATCCGGGGATACTGATTCTGCGAATGATTGAATCCAGTCAATCTACAGCTGATAAAGTTCTTCTGAGAAAGGAAAACAGAGCAGAAGAACACTGCTTGAAGGTTTCTAAGAGATTGGATGACACTGGACCTCAGCTACATCAGCCGTCGTTAATAGGAGCTAAGTCTCTCTTGTCTAGAAACAACAAAATATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

76

Amino Acids

8.38

Weight (kDa)

9.3

Isoelectric Point (pI)

51.21

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001455)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G18490 AT4G18490 AT4G18490 AT4G18490 AT4G18490 AT4G18490 AT4G18490
fragaria_vesca	FvH4_5g25370 FvH4_5g26040 FvH4_5g26040 FvH4_5g26040 FvH4_5g26040 FvH4_5g26040 FvH4_5g26040
malus_domestica	MD05G1304700.v1.1 MD05G1304800.v1.1 MD10G1283800.v1.1
prunus_persica	Prupe.4G057700_v2.0.a1 Prupe.4G057700_v2.0.a1
pyrus_communis	pycom05g28200 pycom05g28990 pycom10g23670
rosa_chinensis	RchiOBHm_Chr7g0215591 RchiOBHm_Chr7g0216741
rosa_laevigata	RLG00000002542 RLG00000002543 RLG00000002645
rosa_multiflora	Rmu_sc0000898.1_g000086 Rmu_sc0003814.1_g000007 Rmu_sc0007602.1_g000013 Rmu_sc0009814.1_g000001
rosa_roxburghii	Rroxscaffold_3G00242970 Rroxscaffold_3G00244080
rosa_rugosa	Rorug06G0072200 Rorug07G0154800 Rorug07G0154900 Rorug07G0162000 Rorug07G0162100
rosa_samantha	Rh2BG169600 Rh2DG168600 Rh7AG291100 Rh7AG303000 Rh7BG283200 Rh7BG293700 Rh7CG311100 Rh7CG321700 Rh7DG294900 Rh7DG302600 Rh7DG302700 Rh7DG302800
rosa_wichuraiana	Rw6G016300 Rw7G024850

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	29
AcoI	YGGCCR	1 cut(s)	3
AgsI	TTSAA	2 cut(s)	65, 133
AluBI	AGCT	3 cut(s)	83, 169, 194
AluI	AGCT	3 cut(s)	83, 169, 194
Alw26I	GTCTC	1 cut(s)	204
AlwI	GGATC	1 cut(s)	29
AoxI	GGCC	1 cut(s)	3
AspS9I	GGNCC	1 cut(s)	161
AsuC2I	CCSGG	1 cut(s)	39
AvaII	GGWCC	1 cut(s)	161
BalI	TGGCCA	1 cut(s)	5
BbvCI	CCTCAGC	1 cut(s)	165
BceAI	ACGGC	1 cut(s)	163
BciVI	GTATCC	1 cut(s)	36
BcnI	CCSGG	1 cut(s)	39
BcoDI	GTCTC	1 cut(s)	204
BfaI	CTAG	1 cut(s)	210
BfmI	CTRYAG	1 cut(s)	78
BfuI	GTATCC	1 cut(s)	36
Bme1390I	CCNGG	1 cut(s)	39
Bme18I	GGWCC	1 cut(s)	161
BmgT120I	GGNCC	1 cut(s)	161
BmrFI	CCNGG	1 cut(s)	39
Bpu10I	CCTNAGC	1 cut(s)	165
BpuMI	CCSGG	1 cut(s)	39
BsaJI	CCNNGG	1 cut(s)	38
Bse1I	ACTGG	2 cut(s)	69, 163
BseDI	CCNNGG	1 cut(s)	38
BseGI	GGATG	1 cut(s)	157
BseMII	CTCAG	2 cut(s)	89, 179
BseNI	ACTGG	2 cut(s)	69, 163
BshFI	GGCC	1 cut(s)	5
BsiSI	CCGG	1 cut(s)	38
BsmAI	GTCTC	1 cut(s)	204
BsnI	GGCC	1 cut(s)	5
Bsp143I	GATC	1 cut(s)	34
BspANI	GGCC	1 cut(s)	5
BspCNI	CTCAG	2 cut(s)	90, 178
BspPI	GGATC	1 cut(s)	29
BsrI	ACTGG	2 cut(s)	69, 163
BssECI	CCNNGG	1 cut(s)	38
BssMI	GATC	1 cut(s)	34
BstDEI	CTNAG	4 cut(s)	98, 141, 165, 195
BstF5I	GGATG	1 cut(s)	157
BstKTI	GATC	1 cut(s)	37
BstMAI	GTCTC	1 cut(s)	204
BstMBI	GATC	1 cut(s)	34
BstMWI	GCNNNNNNNGC	1 cut(s)	175
BstSCI	CCNGG	1 cut(s)	37
BstSFI	CTRYAG	1 cut(s)	78
BsuI	GTATCC	1 cut(s)	36
BsuRI	GGCC	1 cut(s)	5
BtsCI	GGATG	1 cut(s)	157
BtsI	GCAGTG	1 cut(s)	124
BtsIMutI	CAGTG	2 cut(s)	124, 156
Cfr13I	GGNCC	1 cut(s)	161
CviJI	RGCY	5 cut(s)	5, 83, 169, 178, 194
CviKI_1	RGCY	5 cut(s)	5, 83, 169, 178, 194
DdeI	CTNAG	4 cut(s)	98, 141, 165, 195
DpnI	GATC	1 cut(s)	36
DpnII	GATC	1 cut(s)	34
EaeI	YGGCCR	1 cut(s)	3
Eco47I	GGWCC	1 cut(s)	161
FaiI	YATR	2 cut(s)	24, 226
FalI	AAGNNNNNCTT	2 cut(s)	188, 220
FokI	GGATG	1 cut(s)	164
FspBI	CTAG	1 cut(s)	210
HaeIII	GGCC	1 cut(s)	5
HapII	CCGG	1 cut(s)	38
HinfI	GANTC	2 cut(s)	49, 65
HpaII	CCGG	1 cut(s)	38
Hpy188I	TCNGA	1 cut(s)	99
Hpy188III	TCNNGA	1 cut(s)	210
Hpy99I	CGWCG	1 cut(s)	184
HpyAV	CCTTC	1 cut(s)	127
HpyF10VI	GCNNNNNNNGC	1 cut(s)	175
HpyF3I	CTNAG	4 cut(s)	98, 141, 165, 195
Kzo9I	GATC	1 cut(s)	34
LmnI	GCTCC	1 cut(s)	191
LpnPI	CCDG	3 cut(s)	51, 82, 144
MaeI	CTAG	1 cut(s)	210
MalI	GATC	1 cut(s)	36
MboI	GATC	1 cut(s)	34
MboII	GAAGA	2 cut(s)	86, 131
MlsI	TGGCCA	1 cut(s)	5
MluNI	TGGCCA	1 cut(s)	5
MnlI	CCTC	1 cut(s)	174
Mox20I	TGGCCA	1 cut(s)	5
MscI	TGGCCA	1 cut(s)	5
MseI	TTAA	1 cut(s)	185
Msp20I	TGGCCA	1 cut(s)	5
MspA1I	CMGCKG	1 cut(s)	83
MspI	CCGG	1 cut(s)	38
MspR9I	CCNGG	1 cut(s)	39
MwoI	GCNNNNNNNGC	1 cut(s)	175
NciI	CCSGG	1 cut(s)	39
NdeII	GATC	1 cut(s)	34
PfeI	GAWTC	2 cut(s)	49, 65
PspPI	GGNCC	1 cut(s)	161
PvuII	CAGCTG	1 cut(s)	83
SaqAI	TTAA	1 cut(s)	185
Sau3AI	GATC	1 cut(s)	34
Sau96I	GGNCC	1 cut(s)	161
ScrFI	CCNGG	1 cut(s)	39
SetI	ASST	5 cut(s)	85, 138, 166, 171, 196
SfcI	CTRYAG	1 cut(s)	78
SgeI	CNNG	7 cut(s)	50, 51, 81, 142, 171, 217, 222
SinI	GGWCC	1 cut(s)	161
SspMI	CTAG	1 cut(s)	210
StyD4I	CCNGG	1 cut(s)	37
TfiI	GAWTC	2 cut(s)	49, 65
Tru1I	TTAA	1 cut(s)	185
Tru9I	TTAA	1 cut(s)	185
TscAI	CASTG	2 cut(s)	131, 163
TspRI	CASTG	2 cut(s)	131, 163
VpaK11BI	GGWCC	1 cut(s)	161
XbaI	TCTAGA	1 cut(s)	209
XspI	CTAG	1 cut(s)	210

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.