Rh7DG302700

protein At4g18490 isoform X1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0001455
Physical Location & Seq
Forward (+)
34760711 .. 34761534
824 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG302700.1

Sequence Viewer

Length: 492 bp
ATGATGATAGAAGATGGTCCTCATCATGAAGACTTTCCTTTTAAAAATTCATCTCCATTAGATATTGGTAGATTGGGGAGCAGTTATGGTGATAGGAGCATGTCAGACAGTGATACTTTGACAGAAAATGATGAACCAGCTAAAGGTGATTTAGATAATGGAGAGACTTTGGCTTCAGTGGTCTCCAGGAAGACACTGCACAACATCAACAGTATCAAGGGAACCCAAAACTCAAGTTTAAAGCTTCCTTTGTCTACACAGGCCAGTGAATCTACAGTTGATAAAGTTACGCTGAGAAAGGAAAGCAGGGCTGGAGAACTCTGCTCGAAGATTTCTAAGAGATTGGAAAACACTGGACCTCAGTTGTATCAACCGCCATTAATAGGAGGAAAATCTCTCTCGTCTGGAAACAACAAAGTTGGTTCCATGTATATAAGCCCTGCACTTGAGAAAGGGCGAGTTTTGCTCTCCCATAACAATTGCAATAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

163

Amino Acids

17.58

Weight (kDa)

6.42

Isoelectric Point (pI)

45.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 254
AciI CCGC 1 cut(s) 374
AcsI RAATTY 1 cut(s) 46
AcuI CTGAAG 1 cut(s) 159
AfiI CCNNNNNNNGG 2 cut(s) 143, 383
AjnI CCWGG 1 cut(s) 185
AluBI AGCT 2 cut(s) 140, 244
AluI AGCT 2 cut(s) 140, 244
Alw26I GTCTC 2 cut(s) 158, 187
AoxI GGCC 1 cut(s) 261
ApoI RAATTY 1 cut(s) 46
AseI ATTAAT 1 cut(s) 380
Asp700I GAANNNNTTC 1 cut(s) 33
AspS9I GGNCC 2 cut(s) 17, 356
AsuHPI GGTGA 2 cut(s) 101, 158
AvaII GGWCC 2 cut(s) 17, 356
BbsI GAAGAC 2 cut(s) 36, 197
BccI CCATC 1 cut(s) 8
BciT130I CCWGG 1 cut(s) 187
BcoDI GTCTC 2 cut(s) 158, 187
BfmI CTRYAG 1 cut(s) 273
Bme1390I CCNGG 1 cut(s) 187
Bme18I GGWCC 2 cut(s) 17, 356
BmgT120I GGNCC 2 cut(s) 17, 356
BmiI GGNNCC 2 cut(s) 223, 424
BmrFI CCNGG 1 cut(s) 187
BpiI GAAGAC 2 cut(s) 36, 197
BplI GAGNNNNNCTC 2 cut(s) 450, 482
BpmI CTGGAG 2 cut(s) 169, 333
BpuEI CTTGAG 2 cut(s) 217, 467
BsaI GGTCTC 1 cut(s) 187
Bsc4I CCNNNNNNNGG 2 cut(s) 143, 383
Bse1I ACTGG 2 cut(s) 264, 358
BseBI CCWGG 1 cut(s) 187
BseLI CCNNNNNNNGG 2 cut(s) 143, 383
BseMII CTCAG 2 cut(s) 284, 374
BseNI ACTGG 2 cut(s) 264, 358
BsgI GTGCAG 2 cut(s) 182, 426
BshFI GGCC 1 cut(s) 263
BslI CCNNNNNNNGG 2 cut(s) 143, 383
BsmAI GTCTC 2 cut(s) 158, 187
BsnI GGCC 1 cut(s) 263
Bso31I GGTCTC 1 cut(s) 187
BspACI CCGC 1 cut(s) 374
BspANI GGCC 1 cut(s) 263
BspCNI CTCAG 2 cut(s) 285, 373
BspHI TCATGA 1 cut(s) 25
BspLI GGNNCC 2 cut(s) 223, 424
BspTNI GGTCTC 1 cut(s) 187
BsrI ACTGG 2 cut(s) 264, 358
Bst2UI CCWGG 1 cut(s) 187
Bst4CI ACNGT 3 cut(s) 110, 212, 277
BstDEI CTNAG 3 cut(s) 293, 336, 360
BstMAI GTCTC 2 cut(s) 158, 187
BstMWI GCNNNNNNNGC 1 cut(s) 463
BstNI CCWGG 1 cut(s) 187
BstNSI RCATGY 1 cut(s) 103
BstSCI CCNGG 1 cut(s) 185
BstSFI CTRYAG 1 cut(s) 273
BstV2I GAAGAC 2 cut(s) 36, 197
BsuRI GGCC 1 cut(s) 263
BtsI GCAGTG 1 cut(s) 194
BtsIMutI CAGTG 5 cut(s) 115, 183, 194, 271, 351
CciI TCATGA 1 cut(s) 25
Cfr13I GGNCC 2 cut(s) 17, 356
CviAII CATG 3 cut(s) 26, 100, 427
CviJI RGCY 6 cut(s) 140, 173, 244, 263, 311, 438
CviKI_1 RGCY 6 cut(s) 140, 173, 244, 263, 311, 438
DdeI CTNAG 3 cut(s) 293, 336, 360
DraI TTTAAA 2 cut(s) 43, 240
Eco31I GGTCTC 1 cut(s) 187
Eco47I GGWCC 2 cut(s) 17, 356
Eco57I CTGAAG 1 cut(s) 159
EcoRII CCWGG 1 cut(s) 185
FaeI CATG 3 cut(s) 29, 103, 430
FaiI YATR 7 cut(s) 27, 87, 101, 428, 432, 434, 474
FatI CATG 3 cut(s) 25, 99, 426
FblI GTMKAC 1 cut(s) 254
GsuI CTGGAG 2 cut(s) 169, 333
HaeIII GGCC 1 cut(s) 263
Hin1II CATG 3 cut(s) 29, 103, 430
HindIII AAGCTT 1 cut(s) 242
HinfI GANTC 1 cut(s) 269
HphI GGTGA 2 cut(s) 101, 158
Hpy166II GTNNAC 1 cut(s) 255
Hpy188I TCNGA 1 cut(s) 106
Hpy188III TCNNGA 2 cut(s) 26, 405
Hpy8I GTNNAC 1 cut(s) 255
HpyCH4III ACNGT 3 cut(s) 110, 212, 277
HpyCH4V TGCA 3 cut(s) 199, 443, 483
HpyF10VI GCNNNNNNNGC 1 cut(s) 463
HpyF3I CTNAG 3 cut(s) 293, 336, 360
Hsp92II CATG 3 cut(s) 29, 103, 430
LmnI GCTCC 2 cut(s) 78, 96
MaeIII GTNAC 1 cut(s) 286
MboII GAAGA 4 cut(s) 23, 41, 202, 340
MfeI CAATTG 1 cut(s) 478
MluCI AATT 2 cut(s) 46, 478
MnlI CCTC 3 cut(s) 30, 369, 380
MroXI GAANNNNTTC 1 cut(s) 33
MseI TTAA 3 cut(s) 42, 239, 380
MspR9I CCNGG 1 cut(s) 187
MunI CAATTG 1 cut(s) 478
MvaI CCWGG 1 cut(s) 187
MwoI GCNNNNNNNGC 1 cut(s) 463
NlaIII CATG 3 cut(s) 29, 103, 430
NlaIV GGNNCC 2 cut(s) 223, 424
NspI RCATGY 1 cut(s) 103
PagI TCATGA 1 cut(s) 25
PdmI GAANNNNTTC 1 cut(s) 33
PfeI GAWTC 1 cut(s) 269
PfoI TCCNGGA 1 cut(s) 185
PshBI ATTAAT 1 cut(s) 380
Psp6I CCWGG 1 cut(s) 185
PspGI CCWGG 1 cut(s) 185
PspN4I GGNNCC 2 cut(s) 223, 424
PspPI GGNCC 2 cut(s) 17, 356
SaqAI TTAA 3 cut(s) 42, 239, 380
Sau96I GGNCC 2 cut(s) 17, 356
ScrFI CCNGG 1 cut(s) 187
SetI ASST 4 cut(s) 142, 148, 246, 361
SfcI CTRYAG 1 cut(s) 273
SinI GGWCC 2 cut(s) 17, 356
SmlI CTYRAG 2 cut(s) 232, 446
SmoI CTYRAG 2 cut(s) 232, 446
Sse9I AATT 2 cut(s) 46, 478
SsiI CCGC 1 cut(s) 374
StyD4I CCNGG 1 cut(s) 185
TaaI ACNGT 3 cut(s) 110, 212, 277
TaqI TCGA 1 cut(s) 326
TasI AATT 2 cut(s) 46, 478
TfiI GAWTC 1 cut(s) 269
Tru1I TTAA 3 cut(s) 42, 239, 380
Tru9I TTAA 3 cut(s) 42, 239, 380
TscAI CASTG 5 cut(s) 115, 183, 201, 271, 358
TspDTI ATGAA 3 cut(s) 39, 42, 147
TspRI CASTG 5 cut(s) 115, 183, 201, 271, 358
VpaK11BI GGWCC 2 cut(s) 17, 356
VspI ATTAAT 1 cut(s) 380
XapI RAATTY 1 cut(s) 46
XceI RCATGY 1 cut(s) 103
XmiI GTMKAC 1 cut(s) 254
XmnI GAANNNNTTC 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.