Rmu_sc0009814.1_g000001

protein At4g18490 isoform X1

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009814.1
Physical Location & Seq
Forward (+)
244 .. 1504
1261 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009814.1_g000001.1.cds

Sequence Viewer

Length: 773 bp
atggcagaaccatcaaaggggaaatcatcctctgctgatcaaaagaaaaaaagctcttttctagatgaggaaattggtgacgatttcctcagctcctggaaatcaatgtcagtaatgaaagatgatgggatggatttcagctttgatgcaggggccaaaagcaagaaaaaagtgtttgactttgataagctggatatggatttcaatctagacggtgacttcaacaagatatcatctttcaaaatggacatgtctgattttgacttctcaagcccgcccaaaaaagatgcgaaaaccaaggaagttgacacgtcagaccttgatttatcaagccctcccaaaaaagctgcaaaaaccaaggaaagatctgaagaagaaccttccacaggaagccgtcaagggaaacaagaccattttaaattctcttttgatttcaatgagttagatagttttgatctcgattcaactttgtcgagaagagaaaagagttttaagaaccaagatagcagcaaagaggttgtctctgatggagctgggtgtgaaggctctaaagtcgatctagcagaagggattagtaaacttgatggtgtatctgagacagtagccacatcaaagattgatactgtgttagttgatccagggaatactaattctatgaatgactgtgcatcagagtctgagacctctggaaattttgaattgccacctggtccaagatgtcaagaacaaataatgtctgaaagcatagaagagtcaaatcaacaaagtgacgt
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

258

Amino Acids

28.39

Weight (kDa)

4.5

Isoelectric Point (pI)

48.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 275
AclWI GGATC 1 cut(s) 629
AcsI RAATTY 2 cut(s) 419, 691
AcuI CTGAAG 1 cut(s) 390
AfiI CCNNNNNNNGG 2 cut(s) 17, 386
AflIII ACRYGT 2 cut(s) 249, 309
AgsI TTSAA 6 cut(s) 205, 223, 241, 436, 465, 698
AjiI CACGTC 1 cut(s) 312
AjnI CCWGG 3 cut(s) 95, 637, 706
AluBI AGCT 6 cut(s) 54, 93, 141, 190, 347, 533
AluI AGCT 6 cut(s) 54, 93, 141, 190, 347, 533
Alw26I GTCTC 3 cut(s) 526, 590, 674
AlwI GGATC 1 cut(s) 629
AlwNI CAGNNNCTG 2 cut(s) 96, 677
AoxI GGCC 1 cut(s) 153
ApeKI GCWGC 2 cut(s) 347, 507
ApoI RAATTY 2 cut(s) 419, 691
ArsI GACNNNNNNTTYG 2 cut(s) 504, 536
AspS9I GGNCC 2 cut(s) 153, 710
AsuHPI GGTGA 2 cut(s) 89, 227
AvaII GGWCC 1 cut(s) 710
BbvCI CCTCAGC 1 cut(s) 89
BbvI GCAGC 2 cut(s) 334, 519
BccI CCATC 5 cut(s) 19, 119, 124, 521, 578
BceAI ACGGC 1 cut(s) 378
BciT130I CCWGG 3 cut(s) 97, 639, 708
BclI TGATCA 1 cut(s) 37
BcoDI GTCTC 3 cut(s) 526, 590, 674
BfaI CTAG 3 cut(s) 62, 209, 560
BglII AGATCT 1 cut(s) 365
BisI GCNGC 2 cut(s) 348, 508
BlsI GCNGC 2 cut(s) 349, 509
Bme1390I CCNGG 3 cut(s) 97, 639, 708
Bme18I GGWCC 1 cut(s) 710
BmgBI CACGTC 1 cut(s) 312
BmgT120I GGNCC 2 cut(s) 153, 710
BmiI GGNNCC 1 cut(s) 154
BmrFI CCNGG 3 cut(s) 97, 639, 708
BmsI GCATC 3 cut(s) 136, 277, 677
BplI GAGNNNNNCTC 2 cut(s) 506, 538
Bpu10I CCTNAGC 1 cut(s) 89
BpuEI CTTGAG 1 cut(s) 253
BsaBI GATNNNNATC 1 cut(s) 204
BsaI GGTCTC 1 cut(s) 674
BsaJI CCNNGG 3 cut(s) 297, 357, 638
Bsc4I CCNNNNNNNGG 2 cut(s) 17, 386
Bse8I GATNNNNATC 1 cut(s) 204
BseBI CCWGG 3 cut(s) 97, 639, 708
BseDI CCNNGG 3 cut(s) 297, 357, 638
BseGI GGATG 2 cut(s) 26, 135
BseJI GATNNNNATC 1 cut(s) 204
BseLI CCNNNNNNNGG 2 cut(s) 17, 386
BseMII CTCAG 3 cut(s) 103, 585, 669
BseXI GCAGC 2 cut(s) 334, 519
BseYI CCCAGC 1 cut(s) 533
BshFI GGCC 1 cut(s) 155
BslI CCNNNNNNNGG 2 cut(s) 17, 386
BsmAI GTCTC 3 cut(s) 526, 590, 674
BsnI GGCC 1 cut(s) 155
Bso31I GGTCTC 1 cut(s) 674
Bsp143I GATC 5 cut(s) 37, 365, 454, 556, 634
BspACI CCGC 1 cut(s) 275
BspANI GGCC 1 cut(s) 155
BspCNI CTCAG 3 cut(s) 102, 586, 670
BspLI GGNNCC 1 cut(s) 154
BspPI GGATC 1 cut(s) 629
BspTNI GGTCTC 1 cut(s) 674
BssECI CCNNGG 3 cut(s) 297, 357, 638
BssMI GATC 5 cut(s) 37, 365, 454, 556, 634
BssT1I CCWWGG 2 cut(s) 297, 357
Bst2UI CCWGG 3 cut(s) 97, 639, 708
Bst4CI ACNGT 4 cut(s) 215, 601, 625, 665
Bst6I CTCTTC 2 cut(s) 472, 744
BstC8I GCNNGC 1 cut(s) 275
BstDEI CTNAG 3 cut(s) 89, 594, 678
BstENI CCTNNNNNAGG 1 cut(s) 384
BstF5I GGATG 2 cut(s) 26, 135
BstKTI GATC 5 cut(s) 40, 368, 457, 559, 637
BstMAI GTCTC 3 cut(s) 526, 590, 674
BstMBI GATC 5 cut(s) 37, 365, 454, 556, 634
BstNI CCWGG 3 cut(s) 97, 639, 708
BstNSI RCATGY 1 cut(s) 253
BstSCI CCNGG 3 cut(s) 95, 637, 706
BstV1I GCAGC 2 cut(s) 334, 519
BstX2I RGATCY 1 cut(s) 365
BstYI RGATCY 1 cut(s) 365
BsuRI GGCC 1 cut(s) 155
BtrI CACGTC 1 cut(s) 312
BtsCI GGATG 2 cut(s) 26, 135
Cac8I GCNNGC 1 cut(s) 275
CaiI CAGNNNCTG 2 cut(s) 96, 677
Cfr13I GGNCC 2 cut(s) 153, 710
CsiI ACCWGGT 1 cut(s) 706
CviAII CATG 1 cut(s) 250
DdeI CTNAG 3 cut(s) 89, 594, 678
DpnI GATC 5 cut(s) 39, 367, 456, 558, 636
DpnII GATC 5 cut(s) 37, 365, 454, 556, 634
DraI TTTAAA 1 cut(s) 418
Eam1104I CTCTTC 2 cut(s) 472, 744
EarI CTCTTC 2 cut(s) 472, 744
Eco130I CCWWGG 2 cut(s) 297, 357
Eco31I GGTCTC 1 cut(s) 674
Eco32I GATATC 1 cut(s) 231
Eco47I GGWCC 1 cut(s) 710
Eco57I CTGAAG 1 cut(s) 390
EcoNI CCTNNNNNAGG 1 cut(s) 384
EcoRII CCWGG 3 cut(s) 95, 637, 706
EcoRV GATATC 1 cut(s) 231
EcoT14I CCWWGG 2 cut(s) 297, 357
ErhI CCWWGG 2 cut(s) 297, 357
FaeI CATG 1 cut(s) 253
FaiI YATR 4 cut(s) 197, 251, 656, 746
FatI CATG 1 cut(s) 249
FauI CCCGC 1 cut(s) 282
FbaI TGATCA 1 cut(s) 37
Fnu4HI GCNGC 2 cut(s) 348, 508
FokI GGATG 2 cut(s) 13, 142
Fsp4HI GCNGC 2 cut(s) 348, 508
FspBI CTAG 3 cut(s) 62, 209, 560
GluI GCNGC 2 cut(s) 348, 508
GsaI CCCAGC 1 cut(s) 537
HaeIII GGCC 1 cut(s) 155
Hin1II CATG 1 cut(s) 253
HincII GTYRAC 1 cut(s) 307
HindII GTYRAC 1 cut(s) 307
HinfI GANTC 3 cut(s) 461, 674, 752
HphI GGTGA 2 cut(s) 89, 227
Hpy166II GTNNAC 2 cut(s) 307, 578
Hpy188I TCNGA 8 cut(s) 256, 316, 370, 526, 595, 673, 679, 739
Hpy188III TCNNGA 6 cut(s) 62, 209, 458, 474, 687, 722
Hpy8I GTNNAC 2 cut(s) 307, 578
HpyAV CCTTC 3 cut(s) 390, 536, 560
HpyCH4III ACNGT 4 cut(s) 215, 601, 625, 665
HpyCH4IV ACGT 2 cut(s) 311, 771
HpyCH4V TGCA 3 cut(s) 149, 350, 668
HpyF3I CTNAG 3 cut(s) 89, 594, 678
HpySE526I ACGT 2 cut(s) 311, 771
Hsp92II CATG 1 cut(s) 253
Ksp22I TGATCA 1 cut(s) 37
Kzo9I GATC 5 cut(s) 37, 365, 454, 556, 634
LmnI GCTCC 2 cut(s) 98, 530
Lsp1109I GCAGC 2 cut(s) 334, 519
LweI GCATC 3 cut(s) 136, 277, 677
MabI ACCWGGT 1 cut(s) 706
MaeI CTAG 3 cut(s) 62, 209, 560
MaeII ACGT 2 cut(s) 311, 771
MaeIII GTNAC 3 cut(s) 77, 215, 767
MalI GATC 5 cut(s) 39, 367, 456, 558, 636
MboI GATC 5 cut(s) 37, 365, 454, 556, 634
MboII GAAGA 4 cut(s) 383, 386, 489, 761
MflI RGATCY 1 cut(s) 365
MluCI AATT 5 cut(s) 72, 419, 649, 691, 698
MlyI GAGTC 2 cut(s) 683, 761
MnlI CCTC 6 cut(s) 40, 61, 98, 345, 508, 694
MseI TTAA 2 cut(s) 417, 492
MspR9I CCNGG 3 cut(s) 97, 639, 708
MvaI CCWGG 3 cut(s) 97, 639, 708
NdeII GATC 5 cut(s) 37, 365, 454, 556, 634
NlaIII CATG 1 cut(s) 253
NlaIV GGNNCC 1 cut(s) 154
NmuCI GTSAC 3 cut(s) 77, 215, 767
NspI RCATGY 1 cut(s) 253
PciI ACATGT 1 cut(s) 249
PfeI GAWTC 1 cut(s) 461
PfoI TCCNGGA 1 cut(s) 95
PkrI GCNGC 2 cut(s) 349, 509
PleI GAGTC 2 cut(s) 682, 760
PpsI GAGTC 2 cut(s) 682, 760
PscI ACATGT 1 cut(s) 249
Psp6I CCWGG 3 cut(s) 95, 637, 706
PspFI CCCAGC 1 cut(s) 533
PspGI CCWGG 3 cut(s) 95, 637, 706
PspN4I GGNNCC 1 cut(s) 154
PspPI GGNCC 2 cut(s) 153, 710
PstNI CAGNNNCTG 2 cut(s) 96, 677
PsuI RGATCY 1 cut(s) 365
SaqAI TTAA 2 cut(s) 417, 492
SatI GCNGC 2 cut(s) 348, 508
Sau3AI GATC 5 cut(s) 37, 365, 454, 556, 634
Sau96I GGNCC 2 cut(s) 153, 710
SchI GAGTC 2 cut(s) 683, 761
ScrFI CCNGG 3 cut(s) 97, 639, 708
SexAI ACCWGGT 1 cut(s) 706
SfaNI GCATC 3 cut(s) 136, 277, 677
SinI GGWCC 1 cut(s) 710
SmlI CTYRAG 1 cut(s) 268
SmoI CTYRAG 1 cut(s) 268
Sse9I AATT 5 cut(s) 72, 419, 649, 691, 698
SsiI CCGC 1 cut(s) 275
SspMI CTAG 3 cut(s) 62, 209, 560
StyD4I CCNGG 3 cut(s) 95, 637, 706
StyI CCWWGG 2 cut(s) 297, 357
TaaI ACNGT 4 cut(s) 215, 601, 625, 665
TaiI ACGT 1 cut(s) 314
TaqI TCGA 3 cut(s) 459, 473, 555
TasI AATT 5 cut(s) 72, 419, 649, 691, 698
TfiI GAWTC 1 cut(s) 461
Tru1I TTAA 2 cut(s) 417, 492
Tru9I TTAA 2 cut(s) 417, 492
TseFI GTSAC 3 cut(s) 77, 215, 767
TseI GCWGC 2 cut(s) 347, 507
Tsp45I GTSAC 3 cut(s) 77, 215, 767
TspDTI ATGAA 2 cut(s) 131, 671
VpaK11BI GGWCC 1 cut(s) 710
XagI CCTNNNNNAGG 1 cut(s) 384
XapI RAATTY 2 cut(s) 419, 691
XbaI TCTAGA 2 cut(s) 61, 208
XceI RCATGY 1 cut(s) 253
XspI CTAG 3 cut(s) 62, 209, 560
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.