pycom05g28200

protein At4g18490 isoform X1

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
Physical Location & Seq
Reverse (-)
29000858 .. 29001622
765 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g28200.2

Sequence Viewer

Length: 417 bp
ATGCTGACAAATGAAAGCAAAAGTGGAGAATTCCACTCAAAGATTTCTAAGAGATTGAAGGAAGTTGGATCTCAAATGTGTCAGCCATCATTAATAGGAGCAAAATCTCTCTCATCTGGTTTCGTCGGGATTGATACCATGCATCTACGTCCTGCAATTGAGGAAAGGGTGGTTACTAATGCTCATGATGCACAAATTGGAAGCAAATTGCATGATACTCCCCTGTTAGTTGATAAAGAAACAAAAGCCAAACATGTAATATCGGGAAGAGAGGACCTCATGTCTGATGGTGTACCAAACAGGGCCAAACTGGTTCGCAATTCACGGCTGTCTGACAAAGAAGTAACAGAAAGGGAACCTGTCCTGGGAAGTGGACTGAGAAAAAGTCATCATGATCCAAGGCAAGCTTATCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

139

Amino Acids

15.27

Weight (kDa)

9.33

Isoelectric Point (pI)

34.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 76, 389
AcsI RAATTY 1 cut(s) 29
AfaI GTAC 1 cut(s) 294
AfiI CCNNNNNNNGG 1 cut(s) 365
AflIII ACRYGT 1 cut(s) 253
AgsI TTSAA 1 cut(s) 58
AhdI GACNNNNNGTC 1 cut(s) 280
AjnI CCWGG 1 cut(s) 363
AluBI AGCT 1 cut(s) 407
AluI AGCT 1 cut(s) 407
AlwI GGATC 2 cut(s) 76, 389
AoxI GGCC 1 cut(s) 303
ApoI RAATTY 1 cut(s) 29
AseI ATTAAT 1 cut(s) 92
AspS9I GGNCC 2 cut(s) 274, 303
AvaII GGWCC 1 cut(s) 274
BccI CCATC 2 cut(s) 94, 281
BceAI ACGGC 1 cut(s) 341
BciT130I CCWGG 1 cut(s) 365
Bme1390I CCNGG 1 cut(s) 365
Bme18I GGWCC 1 cut(s) 274
BmeRI GACNNNNNGTC 1 cut(s) 280
BmgT120I GGNCC 2 cut(s) 274, 303
BmiI GGNNCC 1 cut(s) 357
BmrFI CCNGG 1 cut(s) 365
BmsI GCATC 2 cut(s) 151, 178
BplI GAGNNNNNCTC 2 cut(s) 261, 293
BsaJI CCNNGG 2 cut(s) 364, 398
Bsc4I CCNNNNNNNGG 1 cut(s) 365
Bse1I ACTGG 1 cut(s) 315
BseBI CCWGG 1 cut(s) 365
BseDI CCNNGG 2 cut(s) 364, 398
BseLI CCNNNNNNNGG 1 cut(s) 365
BseMII CTCAG 1 cut(s) 368
BseNI ACTGG 1 cut(s) 315
BshFI GGCC 1 cut(s) 305
BslI CCNNNNNNNGG 1 cut(s) 365
BsnI GGCC 1 cut(s) 305
Bsp143I GATC 2 cut(s) 68, 394
BspANI GGCC 1 cut(s) 305
BspCNI CTCAG 1 cut(s) 369
BspHI TCATGA 2 cut(s) 184, 391
BspLI GGNNCC 1 cut(s) 357
BspPI GGATC 2 cut(s) 76, 389
BsrI ACTGG 1 cut(s) 315
BssECI CCNNGG 2 cut(s) 364, 398
BssMI GATC 2 cut(s) 68, 394
BssT1I CCWWGG 1 cut(s) 398
Bst2UI CCWGG 1 cut(s) 365
Bst6I CTCTTC 1 cut(s) 262
BstC8I GCNNGC 1 cut(s) 405
BstDEI CTNAG 2 cut(s) 48, 377
BstKTI GATC 2 cut(s) 71, 397
BstMBI GATC 2 cut(s) 68, 394
BstMWI GCNNNNNNNGC 1 cut(s) 188
BstNI CCWGG 1 cut(s) 365
BstNSI RCATGY 1 cut(s) 257
BstSCI CCNGG 1 cut(s) 363
BstX2I RGATCY 1 cut(s) 68
BstYI RGATCY 1 cut(s) 68
BsuRI GGCC 1 cut(s) 305
Cac8I GCNNGC 1 cut(s) 405
CciI TCATGA 2 cut(s) 184, 391
Cfr13I GGNCC 2 cut(s) 274, 303
Csp6I GTAC 1 cut(s) 293
CviAII CATG 6 cut(s) 139, 185, 212, 254, 280, 392
CviJI RGCY 5 cut(s) 85, 248, 305, 328, 407
CviKI_1 RGCY 5 cut(s) 85, 248, 305, 328, 407
CviQI GTAC 1 cut(s) 293
DdeI CTNAG 2 cut(s) 48, 377
DpnI GATC 2 cut(s) 70, 396
DpnII GATC 2 cut(s) 68, 394
DriI GACNNNNNGTC 1 cut(s) 280
Eam1104I CTCTTC 1 cut(s) 262
Eam1105I GACNNNNNGTC 1 cut(s) 280
EarI CTCTTC 1 cut(s) 262
Eco130I CCWWGG 1 cut(s) 398
Eco47I GGWCC 1 cut(s) 274
EcoO109I RGGNCCY 1 cut(s) 274
EcoRI GAATTC 1 cut(s) 29
EcoRII CCWGG 1 cut(s) 363
EcoT14I CCWWGG 1 cut(s) 398
EcoT22I ATGCAT 1 cut(s) 144
ErhI CCWWGG 1 cut(s) 398
FaeI CATG 6 cut(s) 142, 188, 215, 257, 283, 395
FaiI YATR 6 cut(s) 140, 186, 213, 255, 281, 393
FalI AAGNNNNNCTT 1 cut(s) 391
FatI CATG 6 cut(s) 138, 184, 211, 253, 279, 391
HaeIII GGCC 1 cut(s) 305
Hin1II CATG 6 cut(s) 142, 188, 215, 257, 283, 395
HindIII AAGCTT 1 cut(s) 405
Hpy166II GTNNAC 2 cut(s) 293, 374
Hpy188I TCNGA 2 cut(s) 286, 334
Hpy188III TCNNGA 4 cut(s) 127, 185, 264, 392
Hpy8I GTNNAC 2 cut(s) 293, 374
Hpy99I CGWCG 1 cut(s) 128
HpyAV CCTTC 1 cut(s) 52
HpyCH4IV ACGT 1 cut(s) 148
HpyCH4V TGCA 4 cut(s) 142, 155, 191, 211
HpyF10VI GCNNNNNNNGC 1 cut(s) 188
HpyF3I CTNAG 2 cut(s) 48, 377
HpySE526I ACGT 1 cut(s) 148
Hsp92II CATG 6 cut(s) 142, 188, 215, 257, 283, 395
Kzo9I GATC 2 cut(s) 68, 394
LmnI GCTCC 1 cut(s) 98
LpnPI CCDG 8 cut(s) 102, 165, 236, 286, 296, 350, 372, 377
LweI GCATC 2 cut(s) 151, 178
MaeII ACGT 1 cut(s) 148
MaeIII GTNAC 2 cut(s) 172, 343
MalI GATC 2 cut(s) 70, 396
MboI GATC 2 cut(s) 68, 394
MboII GAAGA 1 cut(s) 279
MfeI CAATTG 1 cut(s) 156
MflI RGATCY 1 cut(s) 68
MluCI AATT 5 cut(s) 29, 156, 195, 206, 319
MmeI TCCRAC 1 cut(s) 46
MnlI CCTC 3 cut(s) 154, 265, 287
Mph1103I ATGCAT 1 cut(s) 144
MseI TTAA 2 cut(s) 92, 415
MspR9I CCNGG 1 cut(s) 365
MunI CAATTG 1 cut(s) 156
MvaI CCWGG 1 cut(s) 365
MwoI GCNNNNNNNGC 1 cut(s) 188
NdeII GATC 2 cut(s) 68, 394
NlaIII CATG 6 cut(s) 142, 188, 215, 257, 283, 395
NlaIV GGNNCC 1 cut(s) 357
NsiI ATGCAT 1 cut(s) 144
NspI RCATGY 1 cut(s) 257
PagI TCATGA 2 cut(s) 184, 391
PciI ACATGT 1 cut(s) 253
PpuMI RGGWCCY 1 cut(s) 274
PscI ACATGT 1 cut(s) 253
PshBI ATTAAT 1 cut(s) 92
Psp5II RGGWCCY 1 cut(s) 274
Psp6I CCWGG 1 cut(s) 363
PspGI CCWGG 1 cut(s) 363
PspN4I GGNNCC 1 cut(s) 357
PspPI GGNCC 2 cut(s) 274, 303
PspPPI RGGWCCY 1 cut(s) 274
PsuI RGATCY 1 cut(s) 68
RsaI GTAC 1 cut(s) 294
RsaNI GTAC 1 cut(s) 293
SaqAI TTAA 2 cut(s) 92, 415
Sau3AI GATC 2 cut(s) 68, 394
Sau96I GGNCC 2 cut(s) 274, 303
ScrFI CCNGG 1 cut(s) 365
SetI ASST 4 cut(s) 151, 279, 361, 409
SfaNI GCATC 2 cut(s) 151, 178
SinI GGWCC 1 cut(s) 274
Sse9I AATT 5 cut(s) 29, 156, 195, 206, 319
StyD4I CCNGG 1 cut(s) 363
StyI CCWWGG 1 cut(s) 398
TaiI ACGT 1 cut(s) 151
TasI AATT 5 cut(s) 29, 156, 195, 206, 319
Tru1I TTAA 2 cut(s) 92, 415
Tru9I TTAA 2 cut(s) 92, 415
TspDTI ATGAA 1 cut(s) 27
VpaK11BI GGWCC 1 cut(s) 274
VspI ATTAAT 1 cut(s) 92
XapI RAATTY 1 cut(s) 29
XceI RCATGY 1 cut(s) 257
Zsp2I ATGCAT 1 cut(s) 144
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.