Rh7DG302600

protein At4g18490 isoform X1

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
34757172 .. 34757650
479 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG302600.1

Sequence Viewer

Length: 204 bp
ATGTCAGTAATGAAAGATGACGGGATGGATTTCAGCCTTGATACAGGGGCCAAAAGCAAGAAGAAAGTGTTTGACTTTGATAAGCTGGATATGGATTTCAATCTAGATGGTGACTTCAACAAGATATCATCTTTCAAAATGGACATGTCTGATTTCGACTTCTCAAGCCCCCCCCAAAAAAGATGCAAAAACCAAGGAAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.65

Weight (kDa)

4.8

Isoelectric Point (pI)

39.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 1 cut(s) 144
AgsI TTSAA 3 cut(s) 100, 118, 136
AluBI AGCT 1 cut(s) 85
AluI AGCT 1 cut(s) 85
AoxI GGCC 1 cut(s) 48
AspS9I GGNCC 1 cut(s) 48
AsuHPI GGTGA 1 cut(s) 122
BccI CCATC 2 cut(s) 19, 101
BfaI CTAG 1 cut(s) 104
BmgT120I GGNCC 1 cut(s) 48
BmiI GGNNCC 1 cut(s) 49
BmsI GCATC 1 cut(s) 173
BpuEI CTTGAG 1 cut(s) 148
BsaBI GATNNNNATC 1 cut(s) 99
BsaJI CCNNGG 1 cut(s) 193
Bse8I GATNNNNATC 1 cut(s) 99
BseDI CCNNGG 1 cut(s) 193
BseGI GGATG 1 cut(s) 30
BseJI GATNNNNATC 1 cut(s) 99
BshFI GGCC 1 cut(s) 50
BsnI GGCC 1 cut(s) 50
BspANI GGCC 1 cut(s) 50
BspLI GGNNCC 1 cut(s) 49
BssECI CCNNGG 1 cut(s) 193
BssT1I CCWWGG 1 cut(s) 193
BstF5I GGATG 1 cut(s) 30
BstNSI RCATGY 1 cut(s) 148
BsuRI GGCC 1 cut(s) 50
BtsCI GGATG 1 cut(s) 30
Cfr13I GGNCC 1 cut(s) 48
CviAII CATG 1 cut(s) 145
CviJI RGCY 4 cut(s) 36, 50, 85, 168
CviKI_1 RGCY 4 cut(s) 36, 50, 85, 168
Eco130I CCWWGG 1 cut(s) 193
Eco32I GATATC 1 cut(s) 126
EcoRV GATATC 1 cut(s) 126
EcoT14I CCWWGG 1 cut(s) 193
ErhI CCWWGG 1 cut(s) 193
FaeI CATG 1 cut(s) 148
FaiI YATR 2 cut(s) 92, 146
FatI CATG 1 cut(s) 144
FokI GGATG 1 cut(s) 37
FspBI CTAG 1 cut(s) 104
HaeIII GGCC 1 cut(s) 50
Hin1II CATG 1 cut(s) 148
HphI GGTGA 1 cut(s) 122
Hpy188I TCNGA 1 cut(s) 151
Hpy188III TCNNGA 1 cut(s) 104
HpyCH4V TGCA 1 cut(s) 186
Hsp92II CATG 1 cut(s) 148
LpnPI CCDG 2 cut(s) 30, 71
LweI GCATC 1 cut(s) 173
MaeI CTAG 1 cut(s) 104
MaeIII GTNAC 1 cut(s) 110
MboII GAAGA 1 cut(s) 73
NlaIII CATG 1 cut(s) 148
NlaIV GGNNCC 1 cut(s) 49
NmuCI GTSAC 1 cut(s) 110
NspI RCATGY 1 cut(s) 148
PciI ACATGT 1 cut(s) 144
PscI ACATGT 1 cut(s) 144
PspN4I GGNNCC 1 cut(s) 49
PspPI GGNCC 1 cut(s) 48
Sau96I GGNCC 1 cut(s) 48
SetI ASST 1 cut(s) 87
SfaNI GCATC 1 cut(s) 173
SgeI CNNG 9 cut(s) 34, 50, 57, 70, 98, 116, 133, 157, 177
SmlI CTYRAG 1 cut(s) 163
SmoI CTYRAG 1 cut(s) 163
SspMI CTAG 1 cut(s) 104
StyI CCWWGG 1 cut(s) 193
TaqI TCGA 1 cut(s) 156
TseFI GTSAC 1 cut(s) 110
Tsp45I GTSAC 1 cut(s) 110
TspDTI ATGAA 1 cut(s) 26
XbaI TCTAGA 1 cut(s) 103
XceI RCATGY 1 cut(s) 148
XspI CTAG 1 cut(s) 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.