pycom05g28990

protein At4g18490 isoform X1

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
Physical Location & Seq
Forward (+)
29543447 .. 29543726
280 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g28990.1

Sequence Viewer

Length: 198 bp
ATGTGTCAGCCATCATTGATAGGAGCAACATATCTCTCATGTGGAACCAAAGGGATTGATACCATGCGTCTACATCGTGCAATTGAGCAAGGGGTGGTTACTAATGCTAATGATGCACAAATTGGAAGCAAATTGCCTGAGACTCCTGCCTTAGTTGATAAGGAAACAAAAGCCAAACATGTCATATCGGGAAGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

6.92

Weight (kDa)

8.74

Isoelectric Point (pI)

20.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 70
AflIII ACRYGT 1 cut(s) 178
Alw26I GTCTC 1 cut(s) 134
BccI CCATC 1 cut(s) 19
BcoDI GTCTC 1 cut(s) 134
BmiI GGNNCC 1 cut(s) 46
BmsI GCATC 1 cut(s) 103
BseMII CTCAG 1 cut(s) 129
BsmAI GTCTC 1 cut(s) 134
BspCNI CTCAG 1 cut(s) 130
BspLI GGNNCC 1 cut(s) 46
BstDEI CTNAG 2 cut(s) 138, 151
BstMAI GTCTC 1 cut(s) 134
BstMWI GCNNNNNNNGC 1 cut(s) 113
BstNSI RCATGY 1 cut(s) 182
CseI GACGC 1 cut(s) 56
CviAII CATG 3 cut(s) 39, 64, 179
CviJI RGCY 2 cut(s) 10, 173
CviKI_1 RGCY 2 cut(s) 10, 173
DdeI CTNAG 2 cut(s) 138, 151
FaeI CATG 3 cut(s) 42, 67, 182
FaiI YATR 5 cut(s) 31, 40, 65, 180, 185
FatI CATG 3 cut(s) 38, 63, 178
FblI GTMKAC 1 cut(s) 70
HgaI GACGC 1 cut(s) 56
Hin1II CATG 3 cut(s) 42, 67, 182
HinfI GANTC 1 cut(s) 142
Hpy166II GTNNAC 1 cut(s) 71
Hpy188III TCNNGA 1 cut(s) 189
Hpy8I GTNNAC 1 cut(s) 71
HpyAV CCTTC 1 cut(s) 186
HpyCH4V TGCA 2 cut(s) 80, 116
HpyF10VI GCNNNNNNNGC 1 cut(s) 113
HpyF3I CTNAG 2 cut(s) 138, 151
Hsp92II CATG 3 cut(s) 42, 67, 182
LmnI GCTCC 1 cut(s) 23
LpnPI CCDG 2 cut(s) 150, 159
LweI GCATC 1 cut(s) 103
MaeIII GTNAC 1 cut(s) 97
MfeI CAATTG 1 cut(s) 81
MluCI AATT 3 cut(s) 81, 120, 131
MlyI GAGTC 1 cut(s) 136
MunI CAATTG 1 cut(s) 81
MwoI GCNNNNNNNGC 1 cut(s) 113
NlaIII CATG 3 cut(s) 42, 67, 182
NlaIV GGNNCC 1 cut(s) 46
NspI RCATGY 1 cut(s) 182
PciI ACATGT 1 cut(s) 178
PleI GAGTC 1 cut(s) 136
PpsI GAGTC 1 cut(s) 136
PscI ACATGT 1 cut(s) 178
PspN4I GGNNCC 1 cut(s) 46
SchI GAGTC 1 cut(s) 136
SetI ASST 1 cut(s) 197
SfaNI GCATC 1 cut(s) 103
SgeI CNNG 7 cut(s) 51, 76, 89, 101, 149, 158, 191
Sse9I AATT 3 cut(s) 81, 120, 131
TasI AATT 3 cut(s) 81, 120, 131
XceI RCATGY 1 cut(s) 182
XmiI GTMKAC 1 cut(s) 70
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.