FvH4_7g23100

Ubiquitin-binding WIYLD domain

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb7
Physical Location & Seq
Reverse (-)
18100361 .. 18101158
798 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_7g23100.t1

Sequence Viewer

Length: 165 bp
ATGGCTCCAGGAAGCGGAGGTCTAGGTCGACAACCTAACAAGGTTTCTCGTATGACTGCTATCATCGAGGCTATGGCAGAAATGGGTTTTGAGGCTAAATTGGTTCGTCAGAAAGTGAACCGAAAATTGAAGTTTCAGAAAGACCTTTATGGAAATGAGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

6.01

Weight (kDa)

10.11

Isoelectric Point (pI)

35.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 28
AciI CCGC 1 cut(s) 15
AfiI CCNNNNNNNGG 1 cut(s) 14
AgsI TTSAA 1 cut(s) 130
AjnI CCWGG 1 cut(s) 7
BciT130I CCWGG 1 cut(s) 9
BfaI CTAG 2 cut(s) 23, 163
Bme1390I CCNGG 1 cut(s) 9
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 9
Bsc4I CCNNNNNNNGG 1 cut(s) 14
BseBI CCWGG 1 cut(s) 9
BseLI CCNNNNNNNGG 1 cut(s) 14
BslI CCNNNNNNNGG 1 cut(s) 14
BspACI CCGC 1 cut(s) 15
BspLI GGNNCC 1 cut(s) 6
Bst2UI CCWGG 1 cut(s) 9
BstNI CCWGG 1 cut(s) 9
BstSCI CCNGG 1 cut(s) 7
CviJI RGCY 3 cut(s) 5, 71, 95
CviKI_1 RGCY 3 cut(s) 5, 71, 95
EcoRII CCWGG 1 cut(s) 7
FaiI YATR 3 cut(s) 53, 74, 150
FblI GTMKAC 1 cut(s) 28
FspBI CTAG 2 cut(s) 23, 163
HincII GTYRAC 1 cut(s) 29
HindII GTYRAC 1 cut(s) 29
Hpy166II GTNNAC 2 cut(s) 29, 118
Hpy188I TCNGA 2 cut(s) 111, 138
Hpy8I GTNNAC 2 cut(s) 29, 118
LmnI GCTCC 1 cut(s) 10
LpnPI CCDG 1 cut(s) 21
MaeI CTAG 2 cut(s) 23, 163
MluCI AATT 2 cut(s) 98, 125
MnlI CCTC 3 cut(s) 11, 61, 85
MspR9I CCNGG 1 cut(s) 9
MvaI CCWGG 1 cut(s) 9
NlaIV GGNNCC 1 cut(s) 6
PfoI TCCNGGA 1 cut(s) 7
Psp6I CCWGG 1 cut(s) 7
PspGI CCWGG 1 cut(s) 7
PspN4I GGNNCC 1 cut(s) 6
SalI GTCGAC 1 cut(s) 27
ScrFI CCNGG 1 cut(s) 9
SetI ASST 5 cut(s) 22, 28, 37, 45, 147
SgeI CNNG 6 cut(s) 20, 21, 35, 52, 60, 79
Sse9I AATT 2 cut(s) 98, 125
SsiI CCGC 1 cut(s) 15
SspMI CTAG 2 cut(s) 23, 163
StyD4I CCNGG 1 cut(s) 7
TaqI TCGA 2 cut(s) 28, 66
TasI AATT 2 cut(s) 98, 125
XmiI GTMKAC 1 cut(s) 28
XspI CTAG 2 cut(s) 23, 163
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.