pycom07g19830

isoform X1

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
Physical Location & Seq
Forward (+)
22100321 .. 22100600
280 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g19830.2

Sequence Viewer

Length: 192 bp
ATGCCAGATGCTAACGATTGTCATCGAGAAGACAGACTTGCACCCCGAAGGCCTAGACCTTACTACGGTTGGATTTGTAGCGATGACGAGGAAGATCCAGTGGTAATGGCATCGTCTCCATTGTCAGAGTTGGTTAAATTGCTTATTAGGCCAGATAAGAAGAGAAAGCGGAAGTCGAGGTGGGACATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

7.53

Weight (kDa)

8.71

Isoelectric Point (pI)

88.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 169
AclWI GGATC 1 cut(s) 89
AfiI CCNNNNNNNGG 1 cut(s) 65
AflIII ACRYGT 1 cut(s) 186
Alw26I GTCTC 1 cut(s) 120
AlwI GGATC 1 cut(s) 89
AoxI GGCC 2 cut(s) 50, 149
BbsI GAAGAC 1 cut(s) 36
BcoDI GTCTC 1 cut(s) 120
BfaI CTAG 1 cut(s) 54
BmsI GCATC 1 cut(s) 119
BpiI GAAGAC 1 cut(s) 36
BsaBI GATNNNNATC 1 cut(s) 21
Bsc4I CCNNNNNNNGG 1 cut(s) 65
Bse1I ACTGG 1 cut(s) 98
Bse8I GATNNNNATC 1 cut(s) 21
BseJI GATNNNNATC 1 cut(s) 21
BseLI CCNNNNNNNGG 1 cut(s) 65
BseNI ACTGG 1 cut(s) 98
BshFI GGCC 2 cut(s) 52, 151
BslI CCNNNNNNNGG 1 cut(s) 65
BsmAI GTCTC 1 cut(s) 120
BsmBI CGTCTC 1 cut(s) 120
BsnI GGCC 2 cut(s) 52, 151
Bsp143I GATC 1 cut(s) 94
BspACI CCGC 1 cut(s) 169
BspANI GGCC 2 cut(s) 52, 151
BspPI GGATC 1 cut(s) 89
BsrI ACTGG 1 cut(s) 98
BssMI GATC 1 cut(s) 94
Bst4CI ACNGT 1 cut(s) 68
Bst6I CTCTTC 1 cut(s) 155
BstKTI GATC 1 cut(s) 97
BstMAI GTCTC 1 cut(s) 120
BstMBI GATC 1 cut(s) 94
BstMWI GCNNNNNNNGC 1 cut(s) 148
BstNSI RCATGY 1 cut(s) 190
BstV2I GAAGAC 1 cut(s) 36
BstX2I RGATCY 1 cut(s) 94
BstYI RGATCY 1 cut(s) 94
BsuRI GGCC 2 cut(s) 52, 151
BtgZI GCGATG 1 cut(s) 96
BtsIMutI CAGTG 1 cut(s) 105
CviAII CATG 1 cut(s) 187
CviJI RGCY 2 cut(s) 52, 151
CviKI_1 RGCY 2 cut(s) 52, 151
DpnI GATC 1 cut(s) 96
DpnII GATC 1 cut(s) 94
Eam1104I CTCTTC 1 cut(s) 155
EarI CTCTTC 1 cut(s) 155
Eco147I AGGCCT 1 cut(s) 52
Esp3I CGTCTC 1 cut(s) 120
FaeI CATG 1 cut(s) 190
FaiI YATR 1 cut(s) 188
FalI AAGNNNNNCTT 2 cut(s) 21, 53
FatI CATG 1 cut(s) 186
FspBI CTAG 1 cut(s) 54
HaeIII GGCC 2 cut(s) 52, 151
Hin1II CATG 1 cut(s) 190
Hpy188I TCNGA 1 cut(s) 127
Hpy188III TCNNGA 1 cut(s) 26
HpyAV CCTTC 1 cut(s) 42
HpyCH4III ACNGT 1 cut(s) 68
HpyCH4V TGCA 1 cut(s) 41
HpyF10VI GCNNNNNNNGC 1 cut(s) 148
Hsp92II CATG 1 cut(s) 190
Kzo9I GATC 1 cut(s) 94
LpnPI CCDG 3 cut(s) 18, 111, 165
LweI GCATC 1 cut(s) 119
MaeI CTAG 1 cut(s) 54
MalI GATC 1 cut(s) 96
MboI GATC 1 cut(s) 94
MboII GAAGA 3 cut(s) 41, 104, 172
MflI RGATCY 1 cut(s) 94
MluCI AATT 1 cut(s) 137
MmeI TCCRAC 1 cut(s) 50
MnlI CCTC 2 cut(s) 82, 171
MseI TTAA 1 cut(s) 135
MwoI GCNNNNNNNGC 1 cut(s) 148
NdeII GATC 1 cut(s) 94
NlaIII CATG 1 cut(s) 190
NspI RCATGY 1 cut(s) 190
PceI AGGCCT 1 cut(s) 52
PciI ACATGT 1 cut(s) 186
PscI ACATGT 1 cut(s) 186
PsuI RGATCY 1 cut(s) 94
SaqAI TTAA 1 cut(s) 135
Sau3AI GATC 1 cut(s) 94
SetI ASST 2 cut(s) 61, 182
SfaNI GCATC 1 cut(s) 119
SgeI CNNG 8 cut(s) 17, 38, 50, 57, 66, 100, 110, 164
Sse9I AATT 1 cut(s) 137
SseBI AGGCCT 1 cut(s) 52
SsiI CCGC 1 cut(s) 169
SspMI CTAG 1 cut(s) 54
StuI AGGCCT 1 cut(s) 52
TaaI ACNGT 1 cut(s) 68
TaqI TCGA 2 cut(s) 25, 176
TasI AATT 1 cut(s) 137
Tru1I TTAA 1 cut(s) 135
Tru9I TTAA 1 cut(s) 135
TscAI CASTG 1 cut(s) 105
TspRI CASTG 1 cut(s) 105
XceI RCATGY 1 cut(s) 190
XspI CTAG 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.