Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr00

Orthogroup ID

OG0005532

Physical Location & Seq

Genomic Coordinates Reverse (-)

43006717 .. 43006937

Gene Structure 221 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD00G1182400.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 132 bp

ATGCTCGACATTCTGAAACGATTTCACTCTAAAGAAGAAGAAATTGATGGCATGGATGATGATGATGCAGGAGCTGGGATTTTGTATGTGCATTGTGAGATATGTGAGAAGTTTGTTATCGATGGATTCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

44

Amino Acids

4.92

Weight (kDa)

4.24

Isoelectric Point (pI)

44.5

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005532)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g32050
malus_domestica	MD00G1182400.v1.1 MD12G1073000.v1.1
rosa_chinensis	RchiOBHm_Chr6g0259031 RchiOBHm_Chr7g0184131
rosa_laevigata	RLG00000014562
rosa_multiflora	Rmu_co8134094.1_g000001 Rmu_sc0000049.1_g000001 Rmu_sc0000419.1_g000020 Rmu_sc0000441.1_g000126 Rmu_sc0001192.1_g000045 Rmu_sc0002312.1_g000001 Rmu_sc0002876.1_g000002 Rmu_sc0010605.1_g000001 Rmu_sc0011434.1_g000002 Rmu_ssc0000050.1_g000114
rosa_roxburghii	Rroxscaffold_1G00029840 Rroxscaffold_2G00142140 Rroxscaffold_4G00282660 Rroxscaffold_6G00408520
rosa_rugosa	Rorug05G0585000
rosa_samantha	Rh4AG076700 Rh4CG081600 Rh6AG101500 Rh6BG093500 Rh6BG192100 Rh6DG084800 Rh7AG082500 Rh7BG211600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AluBI	AGCT	1 cut(s)	74
AluI	AGCT	1 cut(s)	74
AlwNI	CAGNNNCTG	1 cut(s)	74
BccI	CCATC	2 cut(s)	41, 116
BfaI	CTAG	1 cut(s)	130
BmsI	GCATC	1 cut(s)	55
Bsa29I	ATCGAT	1 cut(s)	120
BseCI	ATCGAT	1 cut(s)	120
BseGI	GGATG	1 cut(s)	61
BseYI	CCCAGC	1 cut(s)	74
BshVI	ATCGAT	1 cut(s)	120
BspDI	ATCGAT	1 cut(s)	120
BstF5I	GGATG	1 cut(s)	61
Bsu15I	ATCGAT	1 cut(s)	120
BsuTUI	ATCGAT	1 cut(s)	120
BtsCI	GGATG	1 cut(s)	61
CaiI	CAGNNNCTG	1 cut(s)	74
ClaI	ATCGAT	1 cut(s)	120
CviAII	CATG	1 cut(s)	52
CviJI	RGCY	1 cut(s)	74
CviKI_1	RGCY	1 cut(s)	74
FaeI	CATG	1 cut(s)	55
FaiI	YATR	3 cut(s)	53, 87, 103
FatI	CATG	1 cut(s)	51
FokI	GGATG	1 cut(s)	68
FspBI	CTAG	1 cut(s)	130
FspEI	CC	6 cut(s)	33, 38, 54, 60, 61, 108
GsaI	CCCAGC	1 cut(s)	78
Hin1II	CATG	1 cut(s)	55
HinfI	GANTC	1 cut(s)	126
Hpy188I	TCNGA	1 cut(s)	15
HpyCH4V	TGCA	2 cut(s)	68, 91
Hsp92II	CATG	1 cut(s)	55
LmnI	GCTCC	1 cut(s)	71
LpnPI	CCDG	2 cut(s)	54, 60
LweI	GCATC	1 cut(s)	55
MaeI	CTAG	1 cut(s)	130
MboII	GAAGA	2 cut(s)	47, 50
MluCI	AATT	1 cut(s)	42
NlaIII	CATG	1 cut(s)	55
PfeI	GAWTC	1 cut(s)	126
PspFI	CCCAGC	1 cut(s)	74
PstNI	CAGNNNCTG	1 cut(s)	74
SetI	ASST	1 cut(s)	76
SfaNI	GCATC	1 cut(s)	55
SgeI	CNNG	4 cut(s)	17, 64, 81, 87
Sse9I	AATT	1 cut(s)	42
SspMI	CTAG	1 cut(s)	130
TaqI	TCGA	2 cut(s)	6, 120
TasI	AATT	1 cut(s)	42
TfiI	GAWTC	1 cut(s)	126
XspI	CTAG	1 cut(s)	130

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.