Rmu_co8134094.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8134094.1
OG0005532
Physical Location & Seq
Reverse (-)
1 .. 398
398 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8134094.1_g000001.1.cds

Sequence Viewer

Length: 168 bp
atggcgttagagtcatggaaattggattgtgtggcgtcatggccactaggaggagcaaccatggcgtcatgctcatggttggcgccatttctggaatcatcactagggacagaggcggcctttcggcggcccaagacagcagcagcaccaaaagctgcaatttttgcg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

5.89

Weight (kDa)

7.8

Isoelectric Point (pI)

56.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 82
AciI CCGC 2 cut(s) 116, 127
AcoI YGGCCR 1 cut(s) 41
AcyI GRCGYC 3 cut(s) 35, 65, 83
AfiI CCNNNNNNNGG 2 cut(s) 50, 126
AluBI AGCT 1 cut(s) 155
AluI AGCT 1 cut(s) 155
AoxI GGCC 3 cut(s) 41, 117, 128
ApeKI GCWGC 3 cut(s) 140, 143, 155
AspLEI GCGC 1 cut(s) 85
AspS9I GGNCC 1 cut(s) 129
BalI TGGCCA 1 cut(s) 43
BanI GGYRCC 1 cut(s) 82
BbvI GCAGC 3 cut(s) 142, 152, 155
BfaI CTAG 2 cut(s) 47, 104
BfoI RGCGCY 1 cut(s) 86
BisI GCNGC 5 cut(s) 117, 128, 141, 144, 156
BlsI GCNGC 5 cut(s) 118, 129, 142, 145, 157
BmgT120I GGNCC 1 cut(s) 129
BmiI GGNNCC 1 cut(s) 84
BsaHI GRCGYC 3 cut(s) 35, 65, 83
BsaJI CCNNGG 1 cut(s) 60
Bsc4I CCNNNNNNNGG 2 cut(s) 50, 126
BseDI CCNNGG 1 cut(s) 60
BseLI CCNNNNNNNGG 2 cut(s) 50, 126
BseRI GAGGAG 1 cut(s) 66
BseXI GCAGC 3 cut(s) 142, 152, 155
BshFI GGCC 3 cut(s) 43, 119, 130
BshNI GGYRCC 1 cut(s) 82
BslFI GGGAC 1 cut(s) 121
BslI CCNNNNNNNGG 2 cut(s) 50, 126
BsmFI GGGAC 1 cut(s) 121
BsnI GGCC 3 cut(s) 43, 119, 130
Bsp19I CCATGG 1 cut(s) 60
BspACI CCGC 2 cut(s) 116, 127
BspANI GGCC 3 cut(s) 43, 119, 130
BspLI GGNNCC 1 cut(s) 84
BspT107I GGYRCC 1 cut(s) 82
BssECI CCNNGG 1 cut(s) 60
BssNI GRCGYC 3 cut(s) 35, 65, 83
BssT1I CCWWGG 1 cut(s) 60
BstACI GRCGYC 3 cut(s) 35, 65, 83
BstAPI GCANNNNNTGC 1 cut(s) 164
BstDSI CCRYGG 1 cut(s) 60
BstH2I RGCGCY 1 cut(s) 86
BstHHI GCGC 1 cut(s) 85
BstMWI GCNNNNNNNGC 3 cut(s) 62, 152, 164
BstV1I GCAGC 3 cut(s) 142, 152, 155
BsuRI GGCC 3 cut(s) 43, 119, 130
BtgI CCRYGG 1 cut(s) 60
CfoI GCGC 1 cut(s) 85
Cfr13I GGNCC 1 cut(s) 129
CseI GACGC 2 cut(s) 24, 54
CviAII CATG 5 cut(s) 15, 39, 61, 69, 75
CviJI RGCY 4 cut(s) 43, 119, 130, 155
CviKI_1 RGCY 4 cut(s) 43, 119, 130, 155
DinI GGCGCC 1 cut(s) 84
EaeI YGGCCR 1 cut(s) 41
Eco130I CCWWGG 1 cut(s) 60
EcoT14I CCWWGG 1 cut(s) 60
EgeI GGCGCC 1 cut(s) 84
EheI GGCGCC 1 cut(s) 84
ErhI CCWWGG 1 cut(s) 60
FaeI CATG 5 cut(s) 18, 42, 64, 72, 78
FaiI YATR 5 cut(s) 16, 40, 62, 70, 76
FaqI GGGAC 1 cut(s) 121
FatI CATG 5 cut(s) 14, 38, 60, 68, 74
Fnu4HI GCNGC 5 cut(s) 117, 128, 141, 144, 156
Fsp4HI GCNGC 5 cut(s) 117, 128, 141, 144, 156
FspBI CTAG 2 cut(s) 47, 104
GlaI GCGC 1 cut(s) 84
GluI GCNGC 5 cut(s) 117, 128, 141, 144, 156
HaeII RGCGCY 1 cut(s) 86
HaeIII GGCC 3 cut(s) 43, 119, 130
HgaI GACGC 2 cut(s) 24, 54
HhaI GCGC 1 cut(s) 85
Hin1I GRCGYC 3 cut(s) 35, 65, 83
Hin1II CATG 5 cut(s) 18, 42, 64, 72, 78
Hin6I GCGC 1 cut(s) 83
HinP1I GCGC 1 cut(s) 83
HinfI GANTC 2 cut(s) 11, 95
Hpy188III TCNNGA 1 cut(s) 92
HpyCH4V TGCA 1 cut(s) 158
HpyF10VI GCNNNNNNNGC 3 cut(s) 62, 152, 164
Hsp92I GRCGYC 3 cut(s) 35, 65, 83
Hsp92II CATG 5 cut(s) 18, 42, 64, 72, 78
HspAI GCGC 1 cut(s) 83
KasI GGCGCC 1 cut(s) 82
LmnI GCTCC 1 cut(s) 53
LpnPI CCDG 1 cut(s) 77
Lsp1109I GCAGC 3 cut(s) 142, 152, 155
MaeI CTAG 2 cut(s) 47, 104
MlsI TGGCCA 1 cut(s) 43
MluCI AATT 2 cut(s) 20, 159
MluNI TGGCCA 1 cut(s) 43
Mly113I GGCGCC 1 cut(s) 83
MlyI GAGTC 1 cut(s) 20
MnlI CCTC 2 cut(s) 44, 106
Mox20I TGGCCA 1 cut(s) 43
MscI TGGCCA 1 cut(s) 43
MslI CAYNNNNRTG 1 cut(s) 73
Msp20I TGGCCA 1 cut(s) 43
MwoI GCNNNNNNNGC 3 cut(s) 62, 152, 164
NarI GGCGCC 1 cut(s) 83
NcoI CCATGG 1 cut(s) 60
NlaIII CATG 5 cut(s) 18, 42, 64, 72, 78
NlaIV GGNNCC 1 cut(s) 84
PfeI GAWTC 1 cut(s) 95
PkrI GCNGC 5 cut(s) 118, 129, 142, 145, 157
PleI GAGTC 1 cut(s) 19
PluTI GGCGCC 1 cut(s) 86
PpsI GAGTC 1 cut(s) 19
PspN4I GGNNCC 1 cut(s) 84
PspPI GGNCC 1 cut(s) 129
RseI CAYNNNNRTG 1 cut(s) 73
SatI GCNGC 5 cut(s) 117, 128, 141, 144, 156
Sau96I GGNCC 1 cut(s) 129
SchI GAGTC 1 cut(s) 20
SetI ASST 1 cut(s) 157
SfoI GGCGCC 1 cut(s) 84
SgeI CNNG 9 cut(s) 27, 51, 59, 73, 81, 87, 104, 116, 145
SmiMI CAYNNNNRTG 1 cut(s) 73
Sse9I AATT 2 cut(s) 20, 159
SsiI CCGC 2 cut(s) 116, 127
SspDI GGCGCC 1 cut(s) 82
SspMI CTAG 2 cut(s) 47, 104
StyI CCWWGG 1 cut(s) 60
TasI AATT 2 cut(s) 20, 159
TauI GCSGC 2 cut(s) 119, 130
TfiI GAWTC 1 cut(s) 95
TseI GCWGC 3 cut(s) 140, 143, 155
XspI CTAG 2 cut(s) 47, 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.