MD02G1001600.v1.1

Belongs to the universal ribosomal protein uS17 family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr02
Physical Location & Seq
Reverse (-)
108904 .. 109155
252 bp
Loading structure...
UTR
Exon/CDS
Intron
MD02G1001600.v1.1.491

Sequence Viewer

Length: 198 bp
ATGCGCAGGACTTACATTGACAAGAAATGCTCTTTCACTGGAAATGTTTCTACCAGGGGCCGCATCTTGGCTGGCACTTGCCATAGTGCTAAGATGAATAAAACAATCATCGTTCGAAGGAATTATCTACATTATATCAAGAAATATCGGAGGTATGACGTTCGCGATCATTTTTTTCACTTTCTATTGTATCTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

7.97

Weight (kDa)

10.44

Isoelectric Point (pI)

47.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S17_N PF16205 2 - 23 1.8e-08 Ribosomal_S17 N-terminal
Ribosomal_S17 PF00366 25 - 56 1e-07 Ribosomal protein S17
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 5
AccII CGCG 1 cut(s) 165
AciI CCGC 1 cut(s) 61
AfiI CCNNNNNNNGG 1 cut(s) 67
AjnI CCWGG 1 cut(s) 53
AoxI GGCC 1 cut(s) 58
Asp700I GAANNNNTTC 1 cut(s) 46
AspLEI GCGC 1 cut(s) 6
AspS9I GGNCC 1 cut(s) 58
AsuII TTCGAA 1 cut(s) 115
BciT130I CCWGG 1 cut(s) 55
BfmI CTRYAG 1 cut(s) 194
BisI GCNGC 1 cut(s) 61
BlsI GCNGC 1 cut(s) 62
Bme1390I CCNGG 1 cut(s) 55
BmgT120I GGNCC 1 cut(s) 58
BmiI GGNNCC 1 cut(s) 59
BmrFI CCNGG 1 cut(s) 55
BmsI GCATC 1 cut(s) 72
Bpu14I TTCGAA 1 cut(s) 115
BsaJI CCNNGG 1 cut(s) 54
Bsc4I CCNNNNNNNGG 1 cut(s) 67
Bse1I ACTGG 1 cut(s) 43
BseBI CCWGG 1 cut(s) 55
BseDI CCNNGG 1 cut(s) 54
BseLI CCNNNNNNNGG 1 cut(s) 67
BseNI ACTGG 1 cut(s) 43
Bsh1236I CGCG 1 cut(s) 165
BshFI GGCC 1 cut(s) 60
BslI CCNNNNNNNGG 1 cut(s) 67
BsnI GGCC 1 cut(s) 60
Bsp119I TTCGAA 1 cut(s) 115
Bsp143I GATC 1 cut(s) 166
Bsp68I TCGCGA 1 cut(s) 165
BspACI CCGC 1 cut(s) 61
BspANI GGCC 1 cut(s) 60
BspFNI CGCG 1 cut(s) 165
BspLI GGNNCC 1 cut(s) 59
BspT104I TTCGAA 1 cut(s) 115
BsrI ACTGG 1 cut(s) 43
BssECI CCNNGG 1 cut(s) 54
BssMI GATC 1 cut(s) 166
Bst2UI CCWGG 1 cut(s) 55
BstBI TTCGAA 1 cut(s) 115
BstC8I GCNNGC 1 cut(s) 73
BstDEI CTNAG 1 cut(s) 90
BstFNI CGCG 1 cut(s) 165
BstHHI GCGC 1 cut(s) 6
BstKTI GATC 1 cut(s) 169
BstMBI GATC 1 cut(s) 166
BstNI CCWGG 1 cut(s) 55
BstSCI CCNGG 1 cut(s) 53
BstSFI CTRYAG 1 cut(s) 194
BstUI CGCG 1 cut(s) 165
BsuRI GGCC 1 cut(s) 60
BtsIMutI CAGTG 1 cut(s) 36
BtuMI TCGCGA 1 cut(s) 165
Cac8I GCNNGC 1 cut(s) 73
CfoI GCGC 1 cut(s) 6
Cfr13I GGNCC 1 cut(s) 58
CviJI RGCY 2 cut(s) 60, 71
CviKI_1 RGCY 2 cut(s) 60, 71
DdeI CTNAG 1 cut(s) 90
DpnI GATC 1 cut(s) 168
DpnII GATC 1 cut(s) 166
EcoRII CCWGG 1 cut(s) 53
FaiI YATR 3 cut(s) 84, 135, 156
Fnu4HI GCNGC 1 cut(s) 61
Fsp4HI GCNGC 1 cut(s) 61
FspI TGCGCA 1 cut(s) 5
GlaI GCGC 1 cut(s) 5
GluI GCNGC 1 cut(s) 61
HaeIII GGCC 1 cut(s) 60
HhaI GCGC 1 cut(s) 6
Hin6I GCGC 1 cut(s) 4
HinP1I GCGC 1 cut(s) 4
Hpy188I TCNGA 1 cut(s) 150
Hpy188III TCNNGA 2 cut(s) 139, 164
HpyAV CCTTC 1 cut(s) 111
HpyCH4IV ACGT 1 cut(s) 159
HpyF3I CTNAG 1 cut(s) 90
HpySE526I ACGT 1 cut(s) 159
HspAI GCGC 1 cut(s) 4
Kzo9I GATC 1 cut(s) 166
LpnPI CCDG 4 cut(s) 24, 40, 57, 67
LweI GCATC 1 cut(s) 72
MaeII ACGT 1 cut(s) 159
MalI GATC 1 cut(s) 168
MboI GATC 1 cut(s) 166
MluCI AATT 1 cut(s) 121
MnlI CCTC 1 cut(s) 144
MroXI GAANNNNTTC 1 cut(s) 46
MspR9I CCNGG 1 cut(s) 55
MvaI CCWGG 1 cut(s) 55
MvnI CGCG 1 cut(s) 165
NdeII GATC 1 cut(s) 166
NlaIV GGNNCC 1 cut(s) 59
NruI TCGCGA 1 cut(s) 165
NsbI TGCGCA 1 cut(s) 5
NspV TTCGAA 1 cut(s) 115
PdmI GAANNNNTTC 1 cut(s) 46
PkrI GCNGC 1 cut(s) 62
Psp6I CCWGG 1 cut(s) 53
PspGI CCWGG 1 cut(s) 53
PspN4I GGNNCC 1 cut(s) 59
PspPI GGNCC 1 cut(s) 58
RruI TCGCGA 1 cut(s) 165
SatI GCNGC 1 cut(s) 61
Sau3AI GATC 1 cut(s) 166
Sau96I GGNCC 1 cut(s) 58
ScrFI CCNGG 1 cut(s) 55
SetI ASST 2 cut(s) 155, 162
SfaNI GCATC 1 cut(s) 72
SfcI CTRYAG 1 cut(s) 194
SfuI TTCGAA 1 cut(s) 115
Sse9I AATT 1 cut(s) 121
SsiI CCGC 1 cut(s) 61
StyD4I CCNGG 1 cut(s) 53
TaiI ACGT 1 cut(s) 162
TaqI TCGA 1 cut(s) 115
TasI AATT 1 cut(s) 121
TauI GCSGC 1 cut(s) 63
TscAI CASTG 1 cut(s) 43
TspDTI ATGAA 1 cut(s) 110
TspRI CASTG 1 cut(s) 43
XmnI GAANNNNTTC 1 cut(s) 46
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.