MD02G1187300.v1.1

NEMP family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr02
OG0001753
Physical Location & Seq
Reverse (-)
17065530 .. 17066667
1138 bp
Loading structure...
UTR
Exon/CDS
Intron
MD02G1187300.v1.1.491

Sequence Viewer

Length: 363 bp
ATGTACTCTGTATTCTCTTTCAGGCAAGATGTGCTTATAATTCTGCACTACTCCATTTCCCTTACCATCTTGGATTTTAGTTTTATTCAGCTGGCTATATTTCTTCTGGCTTTTGTTTTTCTGGCTGGAGCATGGTTGGGCATCTGGGCAGTCCACAAATTGTTCCTGGCAGAAGATGGATCTATCGAGATAATGACATCTCAGTTTGTTAATTGGTCCATCAAAATTCTGGGTGCTACTGTGATTTTTCAGTCCTTGTTCTCCAGAGAGACAACAACAAAAGCCTTGCAAGAACTTGCTTCTTCTCCTGAGTATCACAGATGGTGCTCCTCAAACGTAGAAAGAATCAGCGTCGCCCCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NEMP

Protein Analysis

121

Amino Acids

13.65

Weight (kDa)

5.82

Isoelectric Point (pI)

52.51

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NEMP PF10225 29 - 101 3.3e-06 NEMP family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 38
AclWI GGATC 1 cut(s) 187
AcsI RAATTY 1 cut(s) 225
AfaI GTAC 1 cut(s) 5
AjnI CCWGG 1 cut(s) 165
AluBI AGCT 1 cut(s) 91
AluI AGCT 1 cut(s) 91
Alw21I GWGCWC 1 cut(s) 329
Alw26I GTCTC 1 cut(s) 263
AlwI GGATC 1 cut(s) 187
ApoI RAATTY 1 cut(s) 225
AspS9I GGNCC 1 cut(s) 216
AvaII GGWCC 1 cut(s) 216
Bbv12I GWGCWC 1 cut(s) 329
BccI CCATC 4 cut(s) 74, 170, 227, 315
BciT130I CCWGG 1 cut(s) 167
BcoDI GTCTC 1 cut(s) 263
Bme1390I CCNGG 1 cut(s) 167
Bme18I GGWCC 1 cut(s) 216
BmgT120I GGNCC 1 cut(s) 216
BmrFI CCNGG 1 cut(s) 167
BmsI GCATC 1 cut(s) 150
BpmI CTGGAG 2 cut(s) 147, 247
BseBI CCWGG 1 cut(s) 167
BseMII CTCAG 2 cut(s) 215, 300
BseRI GAGGAG 1 cut(s) 319
BsgI GTGCAG 1 cut(s) 29
BsiHKAI GWGCWC 1 cut(s) 329
BsmAI GTCTC 1 cut(s) 263
Bsp1286I GDGCHC 1 cut(s) 329
Bsp143I GATC 1 cut(s) 179
BspCNI CTCAG 2 cut(s) 214, 301
BspPI GGATC 1 cut(s) 187
BssMI GATC 1 cut(s) 179
Bst2UI CCWGG 1 cut(s) 167
Bst4CI ACNGT 1 cut(s) 241
BstAPI GCANNNNNTGC 1 cut(s) 31
BstC8I GCNNGC 1 cut(s) 93
BstDEI CTNAG 2 cut(s) 201, 309
BstKTI GATC 1 cut(s) 182
BstMAI GTCTC 1 cut(s) 263
BstMBI GATC 1 cut(s) 179
BstMWI GCNNNNNNNGC 1 cut(s) 31
BstNI CCWGG 1 cut(s) 167
BstSCI CCNGG 1 cut(s) 165
BstX2I RGATCY 1 cut(s) 179
BstYI RGATCY 1 cut(s) 179
Cac8I GCNNGC 1 cut(s) 93
Cfr13I GGNCC 1 cut(s) 216
CseI GACGC 1 cut(s) 340
Csp6I GTAC 1 cut(s) 4
CviAII CATG 1 cut(s) 132
CviJI RGCY 5 cut(s) 91, 95, 110, 125, 284
CviKI_1 RGCY 5 cut(s) 91, 95, 110, 125, 284
CviQI GTAC 1 cut(s) 4
DdeI CTNAG 2 cut(s) 201, 309
DpnI GATC 1 cut(s) 181
DpnII GATC 1 cut(s) 179
Eco47I GGWCC 1 cut(s) 216
EcoRII CCWGG 1 cut(s) 165
FaeI CATG 1 cut(s) 135
FaiI YATR 3 cut(s) 38, 98, 133
FalI AAGNNNNNCTT 2 cut(s) 18, 50
FatI CATG 1 cut(s) 131
GsuI CTGGAG 2 cut(s) 147, 247
HgaI GACGC 1 cut(s) 340
Hin1II CATG 1 cut(s) 135
HinfI GANTC 1 cut(s) 345
Hpy166II GTNNAC 1 cut(s) 154
Hpy188III TCNNGA 3 cut(s) 187, 264, 308
Hpy8I GTNNAC 1 cut(s) 154
Hpy99I CGWCG 1 cut(s) 356
HpyCH4III ACNGT 1 cut(s) 241
HpyCH4IV ACGT 1 cut(s) 336
HpyCH4V TGCA 2 cut(s) 46, 289
HpyF10VI GCNNNNNNNGC 1 cut(s) 31
HpyF3I CTNAG 2 cut(s) 201, 309
HpySE526I ACGT 1 cut(s) 336
Hsp92II CATG 1 cut(s) 135
Kzo9I GATC 1 cut(s) 179
LmnI GCTCC 2 cut(s) 128, 332
LweI GCATC 1 cut(s) 150
MaeII ACGT 1 cut(s) 336
MalI GATC 1 cut(s) 181
MboI GATC 1 cut(s) 179
MboII GAAGA 3 cut(s) 95, 185, 294
MflI RGATCY 1 cut(s) 179
MhlI GDGCHC 1 cut(s) 329
MluCI AATT 4 cut(s) 39, 158, 211, 225
MnlI CCTC 1 cut(s) 340
MseI TTAA 1 cut(s) 210
MspA1I CMGCKG 1 cut(s) 91
MspR9I CCNGG 1 cut(s) 167
MvaI CCWGG 1 cut(s) 167
MwoI GCNNNNNNNGC 1 cut(s) 31
NdeII GATC 1 cut(s) 179
NlaIII CATG 1 cut(s) 135
PfeI GAWTC 1 cut(s) 345
PsiI TTATAA 1 cut(s) 38
Psp6I CCWGG 1 cut(s) 165
PspGI CCWGG 1 cut(s) 165
PspPI GGNCC 1 cut(s) 216
PsuI RGATCY 1 cut(s) 179
PvuII CAGCTG 1 cut(s) 91
RsaI GTAC 1 cut(s) 5
RsaNI GTAC 1 cut(s) 4
SaqAI TTAA 1 cut(s) 210
Sau3AI GATC 1 cut(s) 179
Sau96I GGNCC 1 cut(s) 216
ScrFI CCNGG 1 cut(s) 167
SduI GDGCHC 1 cut(s) 329
SetI ASST 2 cut(s) 93, 339
SfaNI GCATC 1 cut(s) 150
SinI GGWCC 1 cut(s) 216
Sse9I AATT 4 cut(s) 39, 158, 211, 225
StyD4I CCNGG 1 cut(s) 165
TaaI ACNGT 1 cut(s) 241
TaiI ACGT 1 cut(s) 339
TaqI TCGA 1 cut(s) 186
TasI AATT 4 cut(s) 39, 158, 211, 225
TatI WGTACW 1 cut(s) 3
TfiI GAWTC 1 cut(s) 345
Tru1I TTAA 1 cut(s) 210
Tru9I TTAA 1 cut(s) 210
VpaK11BI GGWCC 1 cut(s) 216
XapI RAATTY 1 cut(s) 225
XcmI CCANNNNNNNNNTGG 1 cut(s) 226
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.