Rh5BG402200

NEMP family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
OG0001753
Physical Location & Seq
Forward (+)
65252659 .. 65252947
289 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG402200.1

Sequence Viewer

Length: 289 bp
ATGCCAGTCGGAAAATCTCCAAGTTCTAAGCCTGGCGCTTCGGTGTTGTGTGAACGAGTTCTTGTCTATGGATTGTCAAGGCTTAAACATCTGGATAAGTTTGCCAATACAGTGAAGGTGAAGATATCAACAACATCAAGATTTCAGACTTTTGAGGTTTGTTTCCATAGAAATACGTCCCGTGGGATAGGAATGTGCCCTGACAGCCAGTGGGAGAAAGTTTCCAAGGGGTCCTGGTCTGGATCCATGTCACCTTTTGAGCACAAACTCTTAGCTATACGAACAGCTG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NEMP

Protein Analysis

96

Amino Acids

10.65

Weight (kDa)

10.03

Isoelectric Point (pI)

36.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 237, 250
AjnI CCWGG 2 cut(s) 31, 233
AluBI AGCT 2 cut(s) 275, 287
AluI AGCT 2 cut(s) 275, 287
Alw21I GWGCWC 1 cut(s) 264
AlwI GGATC 2 cut(s) 237, 250
Asp700I GAANNNNTTC 1 cut(s) 57
AspLEI GCGC 1 cut(s) 38
AspS9I GGNCC 1 cut(s) 231
AsuHPI GGTGA 2 cut(s) 130, 243
AvaII GGWCC 1 cut(s) 231
BaeGI GKGCMC 1 cut(s) 200
BamHI GGATCC 1 cut(s) 242
Bbv12I GWGCWC 1 cut(s) 264
BciT130I CCWGG 2 cut(s) 33, 235
BfoI RGCGCY 1 cut(s) 39
Bme1390I CCNGG 2 cut(s) 33, 235
Bme18I GGWCC 1 cut(s) 231
BmgT120I GGNCC 1 cut(s) 231
BmiI GGNNCC 2 cut(s) 232, 244
BmrFI CCNGG 2 cut(s) 33, 235
BsaJI CCNNGG 2 cut(s) 181, 225
Bse1I ACTGG 2 cut(s) 5, 208
BseBI CCWGG 2 cut(s) 33, 235
BseDI CCNNGG 2 cut(s) 181, 225
BseNI ACTGG 2 cut(s) 5, 208
BseSI GKGCMC 1 cut(s) 200
BsiHKAI GWGCWC 1 cut(s) 264
BslFI GGGAC 1 cut(s) 163
BsmFI GGGAC 1 cut(s) 163
Bsp1286I GDGCHC 2 cut(s) 200, 264
Bsp143I GATC 1 cut(s) 242
BspLI GGNNCC 2 cut(s) 232, 244
BspPI GGATC 2 cut(s) 237, 250
BsrI ACTGG 2 cut(s) 5, 208
BssECI CCNNGG 2 cut(s) 181, 225
BssMI GATC 1 cut(s) 242
BssT1I CCWWGG 1 cut(s) 225
Bst2UI CCWGG 2 cut(s) 33, 235
Bst4CI ACNGT 1 cut(s) 112
BstDEI CTNAG 2 cut(s) 27, 271
BstDSI CCRYGG 1 cut(s) 181
BstH2I RGCGCY 1 cut(s) 39
BstHHI GCGC 1 cut(s) 38
BstKTI GATC 1 cut(s) 245
BstMBI GATC 1 cut(s) 242
BstMWI GCNNNNNNNGC 1 cut(s) 204
BstNI CCWGG 2 cut(s) 33, 235
BstSCI CCNGG 2 cut(s) 31, 233
BstSLI GKGCMC 1 cut(s) 200
BstX2I RGATCY 1 cut(s) 242
BstYI RGATCY 1 cut(s) 242
BtgI CCRYGG 1 cut(s) 181
BtsIMutI CAGTG 2 cut(s) 117, 215
CfoI GCGC 1 cut(s) 38
Cfr13I GGNCC 1 cut(s) 231
CviAII CATG 1 cut(s) 247
CviJI RGCY 5 cut(s) 31, 82, 207, 275, 287
CviKI_1 RGCY 5 cut(s) 31, 82, 207, 275, 287
DdeI CTNAG 2 cut(s) 27, 271
DpnI GATC 1 cut(s) 244
DpnII GATC 1 cut(s) 242
Eco130I CCWWGG 1 cut(s) 225
Eco32I GATATC 1 cut(s) 126
Eco47I GGWCC 1 cut(s) 231
EcoO109I RGGNCCY 1 cut(s) 231
EcoRII CCWGG 2 cut(s) 31, 233
EcoRV GATATC 1 cut(s) 126
EcoT14I CCWWGG 1 cut(s) 225
ErhI CCWWGG 1 cut(s) 225
FaeI CATG 1 cut(s) 250
FaiI YATR 4 cut(s) 69, 168, 248, 278
FaqI GGGAC 1 cut(s) 163
FatI CATG 1 cut(s) 246
GlaI GCGC 1 cut(s) 37
HaeII RGCGCY 1 cut(s) 39
HhaI GCGC 1 cut(s) 38
Hin1II CATG 1 cut(s) 250
Hin6I GCGC 1 cut(s) 36
HinP1I GCGC 1 cut(s) 36
HphI GGTGA 2 cut(s) 130, 243
Hpy166II GTNNAC 1 cut(s) 53
Hpy188I TCNGA 2 cut(s) 11, 147
Hpy188III TCNNGA 3 cut(s) 92, 138, 240
Hpy8I GTNNAC 1 cut(s) 53
HpyAV CCTTC 1 cut(s) 109
HpyCH4III ACNGT 1 cut(s) 112
HpyCH4IV ACGT 1 cut(s) 176
HpyF10VI GCNNNNNNNGC 1 cut(s) 204
HpyF3I CTNAG 2 cut(s) 27, 271
HpySE526I ACGT 1 cut(s) 176
Hsp92II CATG 1 cut(s) 250
HspAI GCGC 1 cut(s) 36
Kzo9I GATC 1 cut(s) 242
LpnPI CCDG 9 cut(s) 18, 18, 45, 77, 213, 220, 221, 225, 247
MaeII ACGT 1 cut(s) 176
MaeIII GTNAC 1 cut(s) 249
MalI GATC 1 cut(s) 244
MboI GATC 1 cut(s) 242
MboII GAAGA 1 cut(s) 133
MflI RGATCY 1 cut(s) 242
MhlI GDGCHC 2 cut(s) 200, 264
MnlI CCTC 1 cut(s) 148
MroXI GAANNNNTTC 1 cut(s) 57
MseI TTAA 1 cut(s) 84
MspA1I CMGCKG 1 cut(s) 287
MspR9I CCNGG 2 cut(s) 33, 235
MvaI CCWGG 2 cut(s) 33, 235
MwoI GCNNNNNNNGC 1 cut(s) 204
NdeII GATC 1 cut(s) 242
NlaIII CATG 1 cut(s) 250
NlaIV GGNNCC 2 cut(s) 232, 244
NmuCI GTSAC 1 cut(s) 249
PdmI GAANNNNTTC 1 cut(s) 57
PpuMI RGGWCCY 1 cut(s) 231
Psp5II RGGWCCY 1 cut(s) 231
Psp6I CCWGG 2 cut(s) 31, 233
PspGI CCWGG 2 cut(s) 31, 233
PspN4I GGNNCC 2 cut(s) 232, 244
PspPI GGNCC 1 cut(s) 231
PspPPI RGGWCCY 1 cut(s) 231
PsuI RGATCY 1 cut(s) 242
PvuII CAGCTG 1 cut(s) 287
SaqAI TTAA 1 cut(s) 84
Sau3AI GATC 1 cut(s) 242
Sau96I GGNCC 1 cut(s) 231
ScrFI CCNGG 2 cut(s) 33, 235
SduI GDGCHC 2 cut(s) 200, 264
SetI ASST 6 cut(s) 120, 159, 179, 256, 277, 289
SinI GGWCC 1 cut(s) 231
StyD4I CCNGG 2 cut(s) 31, 233
StyI CCWWGG 1 cut(s) 225
TaaI ACNGT 1 cut(s) 112
TaiI ACGT 1 cut(s) 179
Tru1I TTAA 1 cut(s) 84
Tru9I TTAA 1 cut(s) 84
TscAI CASTG 2 cut(s) 117, 215
TseFI GTSAC 1 cut(s) 249
Tsp45I GTSAC 1 cut(s) 249
TspRI CASTG 2 cut(s) 117, 215
VpaK11BI GGWCC 1 cut(s) 231
XmnI GAANNNNTTC 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.