Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr03

Orthogroup ID

OG0002394

Physical Location & Seq

Genomic Coordinates Forward (+)

2081031 .. 2081955

Gene Structure 925 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD03G1025200.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 345 bp

ATGTCATTACATAATCTGATTGTGTGCTCATCTCTTTTTAATTGTATTATTGTATCAGGCAAAGAAAACCACATTTATGGCAAGGACTTTATGCAGAACGGGCAGGGAACCACCAATATTTTGGTGGATCTGCCAAATGCCTTAATTGTTGCTGGAGATTCAAGAGTTACAGCATATTCCGGCGAAATTAGACCCGAAGAAAAGAAAGTTAAACACATTTCTAAGAATCCTCCAATACGAGCAACATGGTGTCATGATCAATATGAACATAGTCAAACCTGTGAAGTGGAAGAGGGAAAAATAGGCGAATTTTCAAGCAAGGAAAGAAGCATTGCTCTCTCCTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

115

Amino Acids

12.69

Weight (kDa)

6.18

Isoelectric Point (pI)

39.41

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002394)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G55820 AT5G55820 AT5G55820 AT5G55820 AT5G55820 AT5G55820 AT5G55820 AT5G55820 AT5G55820 AT5G55820 AT5G55820
fragaria_vesca	FvH4_7g06090 FvH4_7g06090
malus_domestica	MD00G1168200.v1.1 MD00G1168400.v1.1 MD03G1024600.v1.1 MD03G1025200.v1.1 MD03G1025800.v1.1 MD11G1029700.v1.1 MD11G1030200.v1.1
prunus_persica	Prupe.5G032900_v2.0.a1 Prupe.5G032900_v2.0.a1 Prupe.7G022200_v2.0.a1
pyrus_communis	pycom03g02140 pycom03g02150 pycom11g02320 pycom11g02330
rosa_chinensis	RchiOBHm_Chr1g0333641
rosa_laevigata	RLG00000029543
rosa_multiflora	Rmu_sc0002955.1_g000032 Rmu_sc0004487.1_g000019 Rmu_sc0004487.1_g000020 Rmu_sc0038804.1_g000001
rosa_roxburghii	Rroxscaffold_4G00317360
rosa_rugosa	Rorug01G0110700 Rorug01G0110800
rosa_samantha	Rh1AG133300 Rh1BG102000 Rh1CG127500 Rh1DG139500
rosa_wichuraiana	Rw0G003340 Rw1G011110

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	135
AcsI	RAATTY	1 cut(s)	308
AgsI	TTSAA	2 cut(s)	162, 315
Alw21I	GWGCWC	1 cut(s)	29
AlwI	GGATC	1 cut(s)	135
ApoI	RAATTY	1 cut(s)	308
Bbv12I	GWGCWC	1 cut(s)	29
BclI	TGATCA	1 cut(s)	256
BmiI	GGNNCC	1 cut(s)	109
BpmI	CTGGAG	1 cut(s)	174
Bse3DI	GCAATG	1 cut(s)	330
BseMI	GCAATG	1 cut(s)	330
BsiHKAI	GWGCWC	1 cut(s)	29
BsiSI	CCGG	1 cut(s)	180
Bsp1286I	GDGCHC	1 cut(s)	29
Bsp143I	GATC	2 cut(s)	127, 256
BspHI	TCATGA	1 cut(s)	253
BspLI	GGNNCC	1 cut(s)	109
BspPI	GGATC	1 cut(s)	135
BsrDI	GCAATG	1 cut(s)	330
BssMI	GATC	2 cut(s)	127, 256
Bst6I	CTCTTC	1 cut(s)	285
BstDEI	CTNAG	1 cut(s)	222
BstKTI	GATC	2 cut(s)	130, 259
BstMBI	GATC	2 cut(s)	127, 256
BstMWI	GCNNNNNNNGC	1 cut(s)	100
BstX2I	RGATCY	1 cut(s)	127
BstXI	CCANNNNNNTGG	2 cut(s)	77, 121
BstYI	RGATCY	1 cut(s)	127
CciI	TCATGA	1 cut(s)	253
CviAII	CATG	2 cut(s)	246, 254
DdeI	CTNAG	1 cut(s)	222
DpnI	GATC	2 cut(s)	129, 258
DpnII	GATC	2 cut(s)	127, 256
Eam1104I	CTCTTC	1 cut(s)	285
EarI	CTCTTC	1 cut(s)	285
FaeI	CATG	2 cut(s)	249, 257
FaiI	YATR	8 cut(s)	12, 78, 92, 175, 247, 255, 264, 270
FatI	CATG	2 cut(s)	245, 253
FbaI	TGATCA	1 cut(s)	256
GsuI	CTGGAG	1 cut(s)	174
HapII	CCGG	1 cut(s)	180
Hin1II	CATG	2 cut(s)	249, 257
HinfI	GANTC	2 cut(s)	158, 226
HpaII	CCGG	1 cut(s)	180
Hpy188I	TCNGA	1 cut(s)	18
Hpy188III	TCNNGA	2 cut(s)	162, 254
HpyCH4V	TGCA	1 cut(s)	94
HpyF10VI	GCNNNNNNNGC	1 cut(s)	100
HpyF3I	CTNAG	1 cut(s)	222
Hsp92II	CATG	2 cut(s)	249, 257
Ksp22I	TGATCA	1 cut(s)	256
Kzo9I	GATC	2 cut(s)	127, 256
LpnPI	CCDG	5 cut(s)	42, 89, 138, 193, 292
MaeIII	GTNAC	1 cut(s)	166
MalI	GATC	2 cut(s)	129, 258
MboI	GATC	2 cut(s)	127, 256
MboII	GAAGA	2 cut(s)	209, 302
MflI	RGATCY	1 cut(s)	127
MhlI	GDGCHC	1 cut(s)	29
MluCI	AATT	4 cut(s)	40, 144, 186, 308
MnlI	CCTC	2 cut(s)	240, 286
MseI	TTAA	3 cut(s)	39, 143, 210
MslI	CAYNNNNRTG	1 cut(s)	75
MspI	CCGG	1 cut(s)	180
MwoI	GCNNNNNNNGC	1 cut(s)	100
NdeII	GATC	2 cut(s)	127, 256
NlaIII	CATG	2 cut(s)	249, 257
NlaIV	GGNNCC	1 cut(s)	109
PagI	TCATGA	1 cut(s)	253
PfeI	GAWTC	2 cut(s)	158, 226
PspN4I	GGNNCC	1 cut(s)	109
PsuI	RGATCY	1 cut(s)	127
RseI	CAYNNNNRTG	1 cut(s)	75
SaqAI	TTAA	3 cut(s)	39, 143, 210
Sau3AI	GATC	2 cut(s)	127, 256
SduI	GDGCHC	1 cut(s)	29
SetI	ASST	1 cut(s)	281
SmiMI	CAYNNNNRTG	1 cut(s)	75
Sse9I	AATT	4 cut(s)	40, 144, 186, 308
SspI	AATATT	1 cut(s)	118
TasI	AATT	4 cut(s)	40, 144, 186, 308
TfiI	GAWTC	2 cut(s)	158, 226
Tru1I	TTAA	3 cut(s)	39, 143, 210
Tru9I	TTAA	3 cut(s)	39, 143, 210
TspDTI	ATGAA	1 cut(s)	279
XapI	RAATTY	1 cut(s)	308
XcmI	CCANNNNNNNNNTGG	2 cut(s)	118, 121

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.