Rmu_sc0002955.1_g000032

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002955.1
Physical Location & Seq
Reverse (-)
185594 .. 193858
8265 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002955.1_g000032.1.cds

Sequence Viewer

Length: 4800 bp
atgttagacatttacctcaacccagctctttcactggctagagttcaaagatctaagtcaagacaaagggctctggcaattcgaaacagtacacaaaaaaactgttcacaggataagggcaatgctgatggttatgctggtgaaactatcaagtgtctgatatctaccccacagcctgaaaatgtcgatgaattgaatgaaaatcattctgaagtggaaaaaccaaaaataggagaatttcaaagcaaggaaaaaggttctgacatctactctggtagaattactagatctagaagctctggccatcaggagaactctttagatgtcagtggctctccatgtatttacaagtcaagtgacggtatagctgttgattctattggtacattgacacatctgtctaaccaagtaattcacccactggaattggttagctactctcatataactaatgacagttgtcgagagggggaattaaagctgggagactactcaagcaagaagcgaacagtcgagaaagattctatgtgtgcaaatttggaaagagaagaacacactccaaaggctttacaagagttcaaaggtccttcaatttctaaggatgttgctgggaactcaattgtctgtaggagtcctgttgaagaaacacatctaaatgaggatcatcacatggtaaacaagtccaaatcttcacctgaggcacagaagaaagagggcaaaatgggtttagaaggggtggacagtagtccaaatgctccgtttactgttttgcatgaagaaaaagaagcatcagttttcccaattctgatcaagcaggctgctggtcatcctcaagattctttgctggaggaaacaggagtagcacatccaactagcactaacattgatcaaggaagccaatgcttaaaagagaacccagtttctcttcttcaggacaatttaagactaggaaatgctgaagacttatcttgtgctggaaaaaccatgctggcacagagatttgattttggagggcccagcaaatttttagaattgtcatttggtgctccaaatgttgaatgctcacagtctgaaaatgttggtgaattgaatgataatcatcctgaagtggaaaaacaaaagataggagaatttcaaatcaaggaagaaggcactgacatctactctggtagaattactagatatagaagctctggccatcaggagaactctttaaatgccagtggctcgccctgcattggcaggacaagtagtggtatagcagttgatattgatactgtggaagagtcctgtttaaaaggactttctactcctgctagtaagaaggggatgcagggcagttcatcagtaaaaatgcctcttcccttaatgcacggggaaaagaaactagaagaaggaatgaccatcactaccggtgaaaactgtaactcatccctggaaatggattatctgggcaattgtgaagtttcagccaaagaaatggaggtccagagaggtttagttgaagcctttgaagaggagttcagtaaatctagaacagcgtcacatgacaatgtgatctcatcagtaaaagaatcatttgatgcttatacggatgcagttcctaaaactttgctagaaagtgggagaactccgaaacagaaatgttctatgatagatgatcaaactcccttgcgagtagactgggatggattggtttgtagcctggtaaaagaagtaaaggggtctaatttgtctactgctaatgctgcaacaccaatgaagttggtatcagaagactgtgcagtggattctaatgccctttgtaattctcataaatcaacagatgttgattttgctatggtttctgggcctggttctcatagaatcctagatgcagagattcttgaagttgagaacccttatgctgcttttagggatgagctgaggagtaacttggctcagtcgactgtaaatgcacacatttctccagaatatgtacaaaggagtgccagtgatgacagagaggtaggttgttcagaatcaactgaatgccagattgcagagaactccaaaggaagaagtttttggtattcaatggagggtacatcacctacgcttaaacgaagaaagattgacgataaaagagttcatgacctgtctgcttcagtagccttgagagaagaggttcttcacgctgtcaaaaaagattctatgtgtgcaaacttggaaagagaagaacacagtccaaaggctttacaacaatctcaagggcgttccatttctcaggaggatgatgggaaattaattgtcagtaagagtcctgttgaagaaacacatctaaatgagaatcacatggtagagaggtctgaatctttacccgaggcacagaagaaagagggtggaatgggtttggaaggggtggatagtagtccaaatgctccattcacttttttgcatgaagaaaaagaagcatcagttttctcaagattgatcaagcaggctgctggacatcctctagattctttgcttgaggatgcaggagtagcacttccaactagcattaacattgatagaggaagccaatgcttaaaagaggacccaatttgtcttcatcttcaggatgatttaagagtagaaaatgttgaagattggccttgtgctggaagaaccgtgcttgcaaagagatctgattctggagcgaccagcaacttcaaagaattgtcaggtggtgctccacatgttgaatccttggatttgactagtgcggatgacgcaatgcctgtacttgagaggtttgttataaagacagatgatgaaccatgttgcattgctgaagagggaattagctttgatgagtggaaccttccaaacactgcattagagcgtgccggtattctggagcagctttgcaaatctgcttgcatgcaaactcccgtagcctattctttagcttcctataagttgcataaagttcaaaatctacagcaatctgttccaactggggttttggagcatgtagatctgaggaccacctttcctataaatgataatgttaagcaattaaaggatggtaatagttcttggagtgaggaagttggcccggccttttatggaagatcctattctgattgcctaccaaattttagtggtcaatctagttgggatattaagaaaccttattcctctcctgttggtaatctttgggatagaattgcttcaagctctagtagttcagggaagcgagtgagctcaattccagagcttgcctgtattagtgaagaaaatgagaatacagatgaggtagctgatacttttcaagatggcattgtttcagaagtgttagattgttctccaaaaaggccaccgcttgcagacattacagaaatccctaaccttcttgcttcagtttctaaagctgcagcctacactgatagatttagtctagattcagtagccaccgaattcagtttaacggggactcataagagcgtcaaaaagaagcctggaatccaaagcagcagtaagagaagatataacaataaggagaaccagagtgtatcacgaaagagagccaccggatcacttcagaataggttcaccaagccaaagttttctggaaaaaccagtttgagaaaaggaggccctagtttgtcagaggtggagcccaaacgtaacaatattgtttccaatattacttcctttattccacttgtgcaacagaaacaagcagctgcagccttaccagggaagagggacattaaagtgaaggccctggaggctgctgaagctgcaaagcgtcttgcagaaaggaaagacaatgaacgtaagatgaagaaagaagctatgaaggttgagcgagcaagagtggagcaagagaatctgaggaagttggagctgcagaggaaaaggaaagaagaggagaggaaaaaaattgaggctgatatagcagcaaagaagagagaaagggaaggggaagacaaaaaggagaagcaaagaaaaaggatgcgtgttgaagaagggcggagggagcagagagaacatgaggacaagttacgtgcagaaaaagtaaagaaagaaataaaatgccaagccagtgatggaagaagatgtgagagtaaggactcaaaatgcaataccgtgcataagaaaatggacaaagaaagggaacatgacactcttaggagcatttcagagactgatcctaggagttcctgtgtttcagcaaataatgccagaagtggaacatctgtccatgaagagaagggcttcagtaattttgagcataaggaagaggtacagagcaatttagacaaagccacagaaaatgagaaattggttgtgcagacaagtcaagaacagtcttatgatatctctccatacaaagaatcagatgatgaaaacgacgaagatgacgatagtataccaaataataaatttattccttcgtgggcaagcaaaaattgcctggctctggttgcttctcgccagagtagaactgacccagaggtgttcttccctctcaaaagctttccctgtgtagctgaagccacggactgccatcgattaacaaatgtctttagattctcgctggattttgaagagttgagctgttgtgtggtagccattggttcgcaggatgaattgggctacaaatttgtgttggtagggatcagtggttttggtatatcactccatcttaagcactttggtgtcattggggcgagtctcgctgaggatgtgccacatgcatggctcgaggcactaattgattgggcgccacgtaatcctgctctcgatcaactctatcctagtatgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

1599

Amino Acids

176.7

Weight (kDa)

5.51

Isoelectric Point (pI)

51.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 2783
AasI GACNNNNNNGTC 1 cut(s) 397
AccB1I GGYRCC 1 cut(s) 4756
AccI GTMKAC 4 cut(s) 1680, 1736, 1946, 4402
AciI CCGC 3 cut(s) 2747, 3347, 4003
AclWI GGATC 5 cut(s) 669, 3093, 3568, 4175, 4658
AcoI YGGCCR 2 cut(s) 301, 1195
AcsI RAATTY 8 cut(s) 236, 535, 1022, 1130, 3121, 3443, 4415, 4634
AcyI GRCGYC 1 cut(s) 4757
AfaI GTAC 6 cut(s) 91, 385, 1980, 2086, 2766, 4278
AfiI CCNNNNNNNGG 6 cut(s) 230, 1238, 1441, 2642, 3726, 4453
AflII CTTAAG 1 cut(s) 4679
AflIII ACRYGT 1 cut(s) 2719
AgeI ACCGGT 1 cut(s) 1412
AhlI ACTAGT 1 cut(s) 2741
AjnI CCWGG 7 cut(s) 1434, 1704, 1852, 3484, 3724, 3753, 4446
AjuI GAANNNNNNNTTGG 4 cut(s) 1023, 1055, 2050, 2082
AleI CACNNNNGTG 1 cut(s) 4689
Alw21I GWGCWC 3 cut(s) 1048, 2716, 3233
Alw26I GTCTC 3 cut(s) 480, 4169, 4712
AlwI GGATC 5 cut(s) 669, 3093, 3568, 4175, 4658
AlwNI CAGNNNCTG 1 cut(s) 4178
Ama87I CYCGRG 2 cut(s) 2360, 4736
ApaI GGGCCC 1 cut(s) 1017
ApoI RAATTY 8 cut(s) 236, 535, 1022, 1130, 3121, 3443, 4415, 4634
AseI ATTAAT 1 cut(s) 2285
AsiGI ACCGGT 1 cut(s) 1412
Asp700I GAANNNNTTC 4 cut(s) 2166, 3196, 3575, 4247
AspA2I CCTAGG 1 cut(s) 4184
AspLEI GCGC 1 cut(s) 4759
AsuC2I CCSGG 1 cut(s) 3083
AsuHPI GGTGA 7 cut(s) 152, 407, 684, 1094, 1427, 2082, 3571
AsuII TTCGAA 1 cut(s) 82
AvaI CYCGRG 2 cut(s) 2360, 4736
AvaII GGWCC 4 cut(s) 584, 1486, 2578, 3009
AvrII CCTAGG 1 cut(s) 4184
AxyI CCTNAGG 1 cut(s) 696
BaeGI GKGCMC 1 cut(s) 1017
BalI TGGCCA 2 cut(s) 303, 1197
BanI GGYRCC 1 cut(s) 4756
BanII GRGCYC 4 cut(s) 73, 1017, 3233, 3648
BbsI GAAGAC 4 cut(s) 966, 1782, 2582, 3963
Bbv12I GWGCWC 3 cut(s) 1048, 2716, 3233
BbvCI CCTCAGC 2 cut(s) 1925, 4713
BciT130I CCWGG 7 cut(s) 1436, 1706, 1854, 3486, 3726, 3755, 4448
BclI TGATCA 4 cut(s) 807, 886, 1660, 2472
BcnI CCSGG 1 cut(s) 3083
BcoDI GTCTC 3 cut(s) 480, 4169, 4712
BcuI ACTAGT 1 cut(s) 2741
BfmI CTRYAG 5 cut(s) 625, 2963, 3399, 3714, 3878
BfoI RGCGCY 1 cut(s) 4760
BfrI CTTAAG 1 cut(s) 4679
BglI GCCNNNNNGGC 1 cut(s) 3758
BglII AGATCT 4 cut(s) 50, 287, 2666, 3001
BlnI CCTAGG 1 cut(s) 4184
Bme1390I CCNGG 8 cut(s) 1436, 1706, 1854, 3083, 3486, 3726, 3755, 4448
Bme18I GGWCC 4 cut(s) 584, 1486, 2578, 3009
BmeT110I CYCGRG 2 cut(s) 2360, 4736
BmiI GGNNCC 5 cut(s) 1015, 2580, 2843, 3645, 4758
BmrFI CCNGG 8 cut(s) 1436, 1706, 1854, 3083, 3486, 3726, 3755, 4448
BmrI ACTGGG 3 cut(s) 911, 1693, 2991
BmsI GCATC 8 cut(s) 797, 1320, 1573, 1585, 1864, 2462, 2506, 3975
BmuI ACTGGG 3 cut(s) 911, 1693, 2991
BoxI GACNNNNGTC 2 cut(s) 459, 744
BpiI GAAGAC 4 cut(s) 966, 1782, 2582, 3963
BpmI CTGGAG 5 cut(s) 866, 1953, 2697, 2900, 3776
Bpu10I CCTNAGC 2 cut(s) 1925, 4713
Bpu14I TTCGAA 1 cut(s) 82
BpuEI CTTGAG 7 cut(s) 478, 816, 2176, 2232, 2449, 2531, 2789
BpuMI CCSGG 1 cut(s) 3083
Bsa29I ATCGAT 1 cut(s) 4543
BsaAI YACGTR 2 cut(s) 4037, 4763
BsaBI GATNNNNATC 1 cut(s) 1098
BsaHI GRCGYC 1 cut(s) 4757
BsaJI CCNNGG 7 cut(s) 1434, 2361, 2730, 3725, 3753, 4184, 4530
BsaWI WCCGGW 2 cut(s) 1412, 3557
BsaXI ACNNNNNCTCC 4 cut(s) 1978, 2008, 4180, 4210
Bsc4I CCNNNNNNNGG 6 cut(s) 230, 1238, 1441, 2642, 3726, 4453
Bse118I RCCGGY 2 cut(s) 1412, 2870
Bse1I ACTGG 9 cut(s) 39, 426, 917, 1221, 1688, 1992, 2986, 3606, 4074
Bse21I CCTNAGG 1 cut(s) 696
Bse3DI GCAATG 3 cut(s) 127, 2763, 2808
Bse8I GATNNNNATC 1 cut(s) 1098
BseBI CCWGG 7 cut(s) 1436, 1706, 1854, 3486, 3726, 3755, 4448
BseCI ATCGAT 1 cut(s) 4543
BseDI CCNNGG 7 cut(s) 1434, 2361, 2730, 3725, 3753, 4184, 4530
BseJI GATNNNNATC 1 cut(s) 1098
BseLI CCNNNNNNNGG 6 cut(s) 230, 1238, 1441, 2642, 3726, 4453
BseMI GCAATG 3 cut(s) 127, 2763, 2808
BseMII CTCAG 7 cut(s) 687, 1916, 1955, 2279, 2996, 3854, 4704
BseNI ACTGG 9 cut(s) 39, 426, 917, 1221, 1688, 1992, 2986, 3606, 4074
BseRI GAGGAG 3 cut(s) 1532, 1942, 3914
BseSI GKGCMC 1 cut(s) 1017
BseYI CCCAGC 4 cut(s) 22, 481, 608, 1016
BsgI GTGCAG 3 cut(s) 1803, 4059, 4343
BshNI GGYRCC 1 cut(s) 4756
BshTI ACCGGT 1 cut(s) 1412
BshVI ATCGAT 1 cut(s) 4543
BsiHKAI GWGCWC 3 cut(s) 1048, 2716, 3233
BsiHKCI CYCGRG 2 cut(s) 2360, 4736
BsiSI CCGG 4 cut(s) 1413, 2871, 3083, 3558
BslFI GGGAC 2 cut(s) 3472, 3749
BslI CCNNNNNNNGG 6 cut(s) 230, 1238, 1441, 2642, 3726, 4453
BsmAI GTCTC 3 cut(s) 480, 4169, 4712
BsmFI GGGAC 2 cut(s) 3472, 3749
BsmI GAATGC 2 cut(s) 1064, 2036
BsoBI CYCGRG 2 cut(s) 2360, 4736
Bsp119I TTCGAA 1 cut(s) 82
Bsp120I GGGCCC 1 cut(s) 1013
Bsp1286I GDGCHC 6 cut(s) 73, 1017, 1048, 2716, 3233, 3648
Bsp1407I TGTACA 1 cut(s) 1978
BspACI CCGC 3 cut(s) 2747, 3347, 4003
BspCNI CTCAG 7 cut(s) 688, 1917, 1954, 2278, 2997, 3855, 4705
BspDI ATCGAT 1 cut(s) 4543
BspHI TCATGA 1 cut(s) 2131
BspLI GGNNCC 5 cut(s) 1015, 2580, 2843, 3645, 4758
BspMAI CTGCAG 3 cut(s) 3403, 3718, 3882
BspPI GGATC 5 cut(s) 669, 3093, 3568, 4175, 4658
BspT104I TTCGAA 1 cut(s) 82
BspT107I GGYRCC 1 cut(s) 4756
BspTI CTTAAG 1 cut(s) 4679
BsrDI GCAATG 3 cut(s) 127, 2763, 2808
BsrFI RCCGGY 2 cut(s) 1412, 2870
BsrGI TGTACA 1 cut(s) 1978
BsrI ACTGG 9 cut(s) 39, 426, 917, 1221, 1688, 1992, 2986, 3606, 4074
BssAI RCCGGY 2 cut(s) 1412, 2870
BssECI CCNNGG 7 cut(s) 1434, 2361, 2730, 3725, 3753, 4184, 4530
BssNAI GTATAC 1 cut(s) 4403
BssNI GRCGYC 1 cut(s) 4757
BssT1I CCWWGG 2 cut(s) 2730, 4184
Bst1107I GTATAC 1 cut(s) 4403
Bst2UI CCWGG 7 cut(s) 1436, 1706, 1854, 3486, 3726, 3755, 4448
BstACI GRCGYC 1 cut(s) 4757
BstAFI CTTAAG 1 cut(s) 4679
BstAPI GCANNNNNTGC 2 cut(s) 4211, 4443
BstAUI TGTACA 1 cut(s) 1978
BstBAI YACGTR 2 cut(s) 4037, 4763
BstBI TTCGAA 1 cut(s) 82
BstDSI CCRYGG 1 cut(s) 4530
BstH2I RGCGCY 1 cut(s) 4760
BstHHI GCGC 1 cut(s) 4759
BstMAI GTCTC 3 cut(s) 480, 4169, 4712
BstNI CCWGG 7 cut(s) 1436, 1706, 1854, 3486, 3726, 3755, 4448
BstNSI RCATGY 4 cut(s) 2723, 2908, 2999, 4730
BstPAI GACNNNNGTC 2 cut(s) 459, 744
BstSCI CCNGG 8 cut(s) 1434, 1704, 1852, 3081, 3484, 3724, 3753, 4446
BstSFI CTRYAG 5 cut(s) 625, 2963, 3399, 3714, 3878
BstSLI GKGCMC 1 cut(s) 1017
BstV2I GAAGAC 4 cut(s) 966, 1782, 2582, 3963
BstX2I RGATCY 5 cut(s) 50, 287, 2666, 3001, 3098
BstXI CCANNNNNNTGG 2 cut(s) 1480, 4731
BstYI RGATCY 5 cut(s) 50, 287, 2666, 3001, 3098
BstZ17I GTATAC 1 cut(s) 4403
Bsu15I ATCGAT 1 cut(s) 4543
Bsu36I CCTNAGG 1 cut(s) 696
BsuTUI ATCGAT 1 cut(s) 4543
BtgI CCRYGG 1 cut(s) 4530
BtsI GCAGTG 2 cut(s) 1791, 2853
CaiI CAGNNNCTG 1 cut(s) 4178
CciI TCATGA 1 cut(s) 2131
CfoI GCGC 1 cut(s) 4759
Cfr10I RCCGGY 2 cut(s) 1412, 2870
ClaI ATCGAT 1 cut(s) 4543
CseI GACGC 4 cut(s) 1530, 2762, 3460, 3767
Csp6I GTAC 6 cut(s) 90, 384, 1979, 2085, 2765, 4277
CspAI ACCGGT 1 cut(s) 1412
CspCI CAANNNNNGTGG 2 cut(s) 408, 443
CviQI GTAC 6 cut(s) 90, 384, 1979, 2085, 2765, 4277
DinI GGCGCC 1 cut(s) 4758
DraI TTTAAA 2 cut(s) 1215, 1296
DrdI GACNNNNNNGTC 1 cut(s) 397
DseDI GACNNNNNNGTC 1 cut(s) 397
EaeI YGGCCR 2 cut(s) 301, 1195
EciI GGCGGA 1 cut(s) 4018
Ecl136II GAGCTC 1 cut(s) 3231
Eco130I CCWWGG 2 cut(s) 2730, 4184
Eco24I GRGCYC 4 cut(s) 73, 1017, 3233, 3648
Eco32I GATATC 2 cut(s) 162, 4351
Eco47I GGWCC 4 cut(s) 584, 1486, 2578, 3009
Eco53kI GAGCTC 1 cut(s) 3231
Eco81I CCTNAGG 1 cut(s) 696
Eco88I CYCGRG 2 cut(s) 2360, 4736
EcoICRI GAGCTC 1 cut(s) 3231
EcoO109I RGGNCCY 5 cut(s) 584, 1013, 2578, 3623, 3751
EcoRI GAATTC 1 cut(s) 3443
EcoRII CCWGG 7 cut(s) 1434, 1704, 1852, 3484, 3724, 3753, 4446
EcoRV GATATC 2 cut(s) 162, 4351
EcoT14I CCWWGG 2 cut(s) 2730, 4184
EcoT22I ATGCAT 1 cut(s) 4732
EcoT38I GRGCYC 4 cut(s) 73, 1017, 3233, 3648
EgeI GGCGCC 1 cut(s) 4758
EheI GGCGCC 1 cut(s) 4758
ErhI CCWWGG 2 cut(s) 2730, 4184
FalI AAGNNNNNCTT 2 cut(s) 2154, 2186
FaqI GGGAC 2 cut(s) 3472, 3749
FbaI TGATCA 4 cut(s) 807, 886, 1660, 2472
FblI GTMKAC 4 cut(s) 1680, 1736, 1946, 4402
FriOI GRGCYC 4 cut(s) 73, 1017, 3233, 3648
GlaI GCGC 1 cut(s) 4758
GsaI CCCAGC 4 cut(s) 26, 485, 612, 1020
GsuI CTGGAG 5 cut(s) 866, 1953, 2697, 2900, 3776
HaeII RGCGCY 1 cut(s) 4760
HapII CCGG 4 cut(s) 1413, 2871, 3083, 3558
HgaI GACGC 4 cut(s) 1530, 2762, 3460, 3767
HhaI GCGC 1 cut(s) 4759
Hin1I GRCGYC 1 cut(s) 4757
Hin6I GCGC 1 cut(s) 4757
HinP1I GCGC 1 cut(s) 4757
HincII GTYRAC 1 cut(s) 1947
HindII GTYRAC 1 cut(s) 1947
HindIII AAGCTT 1 cut(s) 4507
HpaII CCGG 4 cut(s) 1413, 2871, 3083, 3558
HphI GGTGA 7 cut(s) 152, 407, 684, 1094, 1427, 2082, 3571
Hpy99I CGWCG 1 cut(s) 4388
HpyCH4IV ACGT 4 cut(s) 3652, 3805, 4036, 4762
HpySE526I ACGT 4 cut(s) 3652, 3805, 4036, 4762
Hsp92I GRCGYC 1 cut(s) 4757
HspAI GCGC 1 cut(s) 4757
KasI GGCGCC 1 cut(s) 4756
Ksp22I TGATCA 4 cut(s) 807, 886, 1660, 2472
LweI GCATC 8 cut(s) 797, 1320, 1573, 1585, 1864, 2462, 2506, 3975
MaeII ACGT 4 cut(s) 3652, 3805, 4036, 4762
MaeIII GTNAC 6 cut(s) 356, 1424, 1542, 1931, 3653, 4032
MfeI CAATTG 2 cut(s) 618, 1456
MflI RGATCY 5 cut(s) 50, 287, 2666, 3001, 3098
MhlI GDGCHC 6 cut(s) 73, 1017, 1048, 2716, 3233, 3648
MlsI TGGCCA 2 cut(s) 303, 1197
MluNI TGGCCA 2 cut(s) 303, 1197
Mly113I GGCGCC 1 cut(s) 4757
MlyI GAGTC 6 cut(s) 640, 1295, 2308, 3454, 4097, 4714
MmeI TCCRAC 4 cut(s) 893, 2558, 3002, 3852
Mox20I TGGCCA 2 cut(s) 303, 1197
Mph1103I ATGCAT 1 cut(s) 4732
MroXI GAANNNNTTC 4 cut(s) 2166, 3196, 3575, 4247
MscI TGGCCA 2 cut(s) 303, 1197
MslI CAYNNNNRTG 6 cut(s) 654, 1551, 2322, 3743, 4689, 4729
Msp20I TGGCCA 2 cut(s) 303, 1197
MspA1I CMGCKG 1 cut(s) 3713
MspCI CTTAAG 1 cut(s) 4679
MspI CCGG 4 cut(s) 1413, 2871, 3083, 3558
MspR9I CCNGG 8 cut(s) 1436, 1706, 1854, 3083, 3486, 3726, 3755, 4448
MunI CAATTG 2 cut(s) 618, 1456
Mva1269I GAATGC 2 cut(s) 1064, 2036
MvaI CCWGG 7 cut(s) 1436, 1706, 1854, 3486, 3726, 3755, 4448
NarI GGCGCC 1 cut(s) 4757
NciI CCSGG 1 cut(s) 3083
NlaIV GGNNCC 5 cut(s) 1015, 2580, 2843, 3645, 4758
NmuCI GTSAC 2 cut(s) 356, 1542
NsiI ATGCAT 1 cut(s) 4732
NspI RCATGY 4 cut(s) 2723, 2908, 2999, 4730
NspV TTCGAA 1 cut(s) 82
OliI CACNNNNGTG 1 cut(s) 4689
PaeI GCATGC 1 cut(s) 2908
PaeR7I CTCGAG 1 cut(s) 4736
PagI TCATGA 1 cut(s) 2131
PciI ACATGT 1 cut(s) 2719
PcsI WCGNNNNNNNCGW 1 cut(s) 4392
PctI GAATGC 2 cut(s) 1064, 2036
PdmI GAANNNNTTC 4 cut(s) 2166, 3196, 3575, 4247
PinAI ACCGGT 1 cut(s) 1412
PleI GAGTC 6 cut(s) 639, 1294, 2307, 3454, 4097, 4713
PluTI GGCGCC 1 cut(s) 4760
PpsI GAGTC 6 cut(s) 639, 1294, 2307, 3454, 4097, 4713
Ppu21I YACGTR 2 cut(s) 4037, 4763
PpuMI RGGWCCY 2 cut(s) 584, 2578
PscI ACATGT 1 cut(s) 2719
PshAI GACNNNNGTC 2 cut(s) 459, 744
PshBI ATTAAT 1 cut(s) 2285
PsiI TTATAA 1 cut(s) 2783
Psp124BI GAGCTC 1 cut(s) 3233
Psp5II RGGWCCY 2 cut(s) 584, 2578
Psp6I CCWGG 7 cut(s) 1434, 1704, 1852, 3484, 3724, 3753, 4446
PspFI CCCAGC 4 cut(s) 22, 481, 608, 1016
PspGI CCWGG 7 cut(s) 1434, 1704, 1852, 3484, 3724, 3753, 4446
PspN4I GGNNCC 5 cut(s) 1015, 2580, 2843, 3645, 4758
PspOMI GGGCCC 1 cut(s) 1013
PspPPI RGGWCCY 2 cut(s) 584, 2578
PspXI VCTCGAGB 1 cut(s) 4736
PstI CTGCAG 3 cut(s) 3403, 3718, 3882
PstNI CAGNNNCTG 1 cut(s) 4178
PsuI RGATCY 5 cut(s) 50, 287, 2666, 3001, 3098
PvuII CAGCTG 1 cut(s) 3713
RsaI GTAC 6 cut(s) 91, 385, 1980, 2086, 2766, 4278
RsaNI GTAC 6 cut(s) 90, 384, 1979, 2085, 2765, 4277
RseI CAYNNNNRTG 6 cut(s) 654, 1551, 2322, 3743, 4689, 4729
SacI GAGCTC 1 cut(s) 3233
SalI GTCGAC 1 cut(s) 1945
SchI GAGTC 6 cut(s) 640, 1295, 2308, 3454, 4097, 4714
ScrFI CCNGG 8 cut(s) 1436, 1706, 1854, 3083, 3486, 3726, 3755, 4448
SduI GDGCHC 6 cut(s) 73, 1017, 1048, 2716, 3233, 3648
SfaNI GCATC 8 cut(s) 797, 1320, 1573, 1585, 1864, 2462, 2506, 3975
SfcI CTRYAG 5 cut(s) 625, 2963, 3399, 3714, 3878
SfoI GGCGCC 1 cut(s) 4758
Sfr274I CTCGAG 1 cut(s) 4736
SfuI TTCGAA 1 cut(s) 82
SinI GGWCC 4 cut(s) 584, 1486, 2578, 3009
SlaI CTCGAG 1 cut(s) 4736
SmiMI CAYNNNNRTG 6 cut(s) 654, 1551, 2322, 3743, 4689, 4729
SmlI CTYRAG 9 cut(s) 493, 831, 2155, 2247, 2464, 2510, 2768, 4679, 4736
SmoI CTYRAG 9 cut(s) 493, 831, 2155, 2247, 2464, 2510, 2768, 4679, 4736
SpeI ACTAGT 1 cut(s) 2741
SphI GCATGC 1 cut(s) 2908
SsiI CCGC 3 cut(s) 2747, 3347, 4003
SspDI GGCGCC 1 cut(s) 4756
SspI AATATT 2 cut(s) 3661, 3673
SstI GAGCTC 1 cut(s) 3233
StyD4I CCNGG 8 cut(s) 1434, 1704, 1852, 3081, 3484, 3724, 3753, 4446
StyI CCWWGG 2 cut(s) 2730, 4184
TaiI ACGT 4 cut(s) 3655, 3808, 4039, 4765
TaqI TCGA 8 cut(s) 82, 186, 463, 513, 1946, 4543, 4737, 4776
TatI WGTACW 3 cut(s) 89, 1978, 2764
TseFI GTSAC 2 cut(s) 356, 1542
Tsp45I GTSAC 2 cut(s) 356, 1542
TspGWI ACGGA 3 cut(s) 747, 1607, 4547
Vha464I CTTAAG 1 cut(s) 4679
VpaK11BI GGWCC 4 cut(s) 584, 1486, 2578, 3009
VspI ATTAAT 1 cut(s) 2285
XapI RAATTY 8 cut(s) 236, 535, 1022, 1130, 3121, 3443, 4415, 4634
XbaI TCTAGA 4 cut(s) 290, 1532, 2497, 3424
XceI RCATGY 4 cut(s) 2723, 2908, 2999, 4730
XcmI CCANNNNNNNNNTGG 1 cut(s) 4076
XhoI CTCGAG 1 cut(s) 4736
XmaJI CCTAGG 1 cut(s) 4184
XmiI GTMKAC 4 cut(s) 1680, 1736, 1946, 4402
XmnI GAANNNNTTC 4 cut(s) 2166, 3196, 3575, 4247
Zsp2I ATGCAT 1 cut(s) 4732
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.