Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr05

Orthogroup ID

OG0003427

Physical Location & Seq

Genomic Coordinates Reverse (-)

31469292 .. 31470678

Gene Structure 1387 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD05G1186500.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 273 bp

ATGGAAAAGGGGTCCCAACGCCAAACCGAAAGCGAAAGGGCCGACCTTGACGCCATTGCCGCCCTCAAAGAAAGCTCTGCCATTGAGTTCAAGGAAAAGGGGAACGAGTGTGTGAAAAAAGGGAAAAAGCATTTTTCGGAAGCCATGGACTGCTACACGAGGGCAATCAATCAGCAAGCTTTGACCGATTCCGACATCTCAATTCTCTTTTCGAATCGAGCCCATGTCAATCTTTTGCTTGGAAACTATAGACGCGCTCTTACTGATGCCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

TPR_19 TPR_8

Protein Analysis

91

Amino Acids

10.08

Weight (kDa)

6.72

Isoelectric Point (pI)

33.43

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003427)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G04130 AT1G04130
fragaria_vesca	FvH4_2g20260 FvH4_2g20260 FvH4_2g20260
malus_domestica	MD05G1186300.v1.1 MD05G1186500.v1.1 MD10G1174200.v1.1 MD10G1174300.v1.1
prunus_persica	Prupe.1G573100_v2.0.a1 Prupe.8G213100_v2.0.a1
pyrus_communis	pycom10g15020 pycom10g15030
rosa_chinensis	RchiOBHm_Chr6g0286031 RchiOBHm_Chr6g0286041
rosa_laevigata	RLG00000012587 RLG00000012588
rosa_multiflora	Rmu_co8274415.1_g000001
rosa_roxburghii	Rroxscaffold_3G00230420 Rroxscaffold_3G00250000 Rroxscaffold_7G00182510
rosa_rugosa	Rorug06G0178400 Rorug06G0178500
rosa_samantha	Rh5CG093800 Rh6AG290400 Rh6AG290500 Rh6BG107700 Rh6BG293900 Rh6BG294000 Rh6CG293400 Rh6CG293500 Rh6DG285500 Rh6DG285600 Rh7CG476900 Rh7DG446100
rosa_wichuraiana	Rw6G025030

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	255
AciI	CCGC	1 cut(s)	60
AcyI	GRCGYC	1 cut(s)	51
AgsI	TTSAA	1 cut(s)	91
AluBI	AGCT	2 cut(s)	75, 179
AluI	AGCT	2 cut(s)	75, 179
AoxI	GGCC	1 cut(s)	39
AspLEI	GCGC	1 cut(s)	257
AspS9I	GGNCC	2 cut(s)	12, 39
AsuII	TTCGAA	1 cut(s)	212
AvaII	GGWCC	1 cut(s)	12
BanII	GRGCYC	1 cut(s)	223
BauI	CACGAG	1 cut(s)	157
BfaI	CTAG	1 cut(s)	271
BfmI	CTRYAG	1 cut(s)	247
BisI	GCNGC	1 cut(s)	60
BlsI	GCNGC	1 cut(s)	61
Bme18I	GGWCC	1 cut(s)	12
BmgT120I	GGNCC	2 cut(s)	12, 39
BmiI	GGNNCC	2 cut(s)	13, 14
BmsI	GCATC	1 cut(s)	256
Bpu14I	TTCGAA	1 cut(s)	212
BsaHI	GRCGYC	1 cut(s)	51
BsaJI	CCNNGG	1 cut(s)	144
Bse3DI	GCAATG	1 cut(s)	54
BseDI	CCNNGG	1 cut(s)	144
BseMI	GCAATG	1 cut(s)	54
Bsh1236I	CGCG	1 cut(s)	255
BshFI	GGCC	1 cut(s)	41
BsnI	GGCC	1 cut(s)	41
Bsp119I	TTCGAA	1 cut(s)	212
Bsp1286I	GDGCHC	1 cut(s)	223
Bsp19I	CCATGG	1 cut(s)	144
BspACI	CCGC	1 cut(s)	60
BspANI	GGCC	1 cut(s)	41
BspFNI	CGCG	1 cut(s)	255
BspLI	GGNNCC	2 cut(s)	13, 14
BspT104I	TTCGAA	1 cut(s)	212
BsrDI	GCAATG	1 cut(s)	54
BssECI	CCNNGG	1 cut(s)	144
BssNI	GRCGYC	1 cut(s)	51
BssSI	CACGAG	1 cut(s)	157
BssT1I	CCWWGG	1 cut(s)	144
Bst2BI	CACGAG	1 cut(s)	157
BstACI	GRCGYC	1 cut(s)	51
BstBI	TTCGAA	1 cut(s)	212
BstC8I	GCNNGC	1 cut(s)	177
BstDSI	CCRYGG	1 cut(s)	144
BstFNI	CGCG	1 cut(s)	255
BstHHI	GCGC	1 cut(s)	257
BstMWI	GCNNNNNNNGC	1 cut(s)	59
BstSFI	CTRYAG	1 cut(s)	247
BstUI	CGCG	1 cut(s)	255
BsuRI	GGCC	1 cut(s)	41
BtgI	CCRYGG	1 cut(s)	144
Cac8I	GCNNGC	1 cut(s)	177
CfoI	GCGC	1 cut(s)	257
Cfr13I	GGNCC	2 cut(s)	12, 39
CseI	GACGC	2 cut(s)	59, 261
CviAII	CATG	2 cut(s)	145, 224
CviJI	RGCY	5 cut(s)	41, 75, 143, 179, 221
CviKI_1	RGCY	5 cut(s)	41, 75, 143, 179, 221
Eco130I	CCWWGG	1 cut(s)	144
Eco24I	GRGCYC	1 cut(s)	223
Eco47I	GGWCC	1 cut(s)	12
EcoO109I	RGGNCCY	1 cut(s)	12
EcoT14I	CCWWGG	1 cut(s)	144
EcoT38I	GRGCYC	1 cut(s)	223
ErhI	CCWWGG	1 cut(s)	144
FaeI	CATG	2 cut(s)	148, 227
FaiI	YATR	3 cut(s)	146, 225, 249
FatI	CATG	2 cut(s)	144, 223
Fnu4HI	GCNGC	1 cut(s)	60
FriOI	GRGCYC	1 cut(s)	223
Fsp4HI	GCNGC	1 cut(s)	60
FspBI	CTAG	1 cut(s)	271
GlaI	GCGC	1 cut(s)	256
GluI	GCNGC	1 cut(s)	60
HaeIII	GGCC	1 cut(s)	41
HgaI	GACGC	2 cut(s)	59, 261
HhaI	GCGC	1 cut(s)	257
Hin1I	GRCGYC	1 cut(s)	51
Hin1II	CATG	2 cut(s)	148, 227
Hin6I	GCGC	1 cut(s)	255
HinP1I	GCGC	1 cut(s)	255
HindIII	AAGCTT	1 cut(s)	177
HinfI	GANTC	2 cut(s)	188, 214
Hpy188I	TCNGA	2 cut(s)	139, 193
HpyF10VI	GCNNNNNNNGC	1 cut(s)	59
Hsp92I	GRCGYC	1 cut(s)	51
Hsp92II	CATG	2 cut(s)	148, 227
HspAI	GCGC	1 cut(s)	255
KflI	GGGWCCC	1 cut(s)	12
LweI	GCATC	1 cut(s)	256
MaeI	CTAG	1 cut(s)	271
MhlI	GDGCHC	1 cut(s)	223
MluCI	AATT	1 cut(s)	201
MmeI	TCCRAC	1 cut(s)	216
MnlI	CCTC	2 cut(s)	74, 153
MvnI	CGCG	1 cut(s)	255
MwoI	GCNNNNNNNGC	1 cut(s)	59
NcoI	CCATGG	1 cut(s)	144
NlaIII	CATG	2 cut(s)	148, 227
NlaIV	GGNNCC	2 cut(s)	13, 14
NspV	TTCGAA	1 cut(s)	212
PfeI	GAWTC	2 cut(s)	188, 214
PkrI	GCNGC	1 cut(s)	61
PpuMI	RGGWCCY	1 cut(s)	12
Psp5II	RGGWCCY	1 cut(s)	12
PspN4I	GGNNCC	2 cut(s)	13, 14
PspPI	GGNCC	2 cut(s)	12, 39
PspPPI	RGGWCCY	1 cut(s)	12
SatI	GCNGC	1 cut(s)	60
Sau96I	GGNCC	2 cut(s)	12, 39
SduI	GDGCHC	1 cut(s)	223
SetI	ASST	3 cut(s)	48, 77, 181
SfaNI	GCATC	1 cut(s)	256
SfcI	CTRYAG	1 cut(s)	247
SfuI	TTCGAA	1 cut(s)	212
SinI	GGWCC	1 cut(s)	12
Sse9I	AATT	1 cut(s)	201
SsiI	CCGC	1 cut(s)	60
SspMI	CTAG	1 cut(s)	271
StyI	CCWWGG	1 cut(s)	144
TaqI	TCGA	2 cut(s)	212, 217
TaqII	GACCGA	1 cut(s)	200
TasI	AATT	1 cut(s)	201
TauI	GCSGC	1 cut(s)	62
TfiI	GAWTC	2 cut(s)	188, 214
VpaK11BI	GGWCC	1 cut(s)	12
XspI	CTAG	1 cut(s)	271

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.