Rh5CG093800

Tetratricopeptide repeat protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Reverse (-)
7438742 .. 7438984
243 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG093800.1

Sequence Viewer

Length: 168 bp
ATGGCATTATGGATGGAGAAAGGCGCTGAACCCCAAACCGAAAGCGAAAAAGCTGACCTTGATGCCATCGCCTCCCTCAAAGAATCTGCTGCTATTGAACTCAAGGAGAAGGGCAACGAGTTTATGAAAAAGGGTAAGAAGCATTACTTGGATGCCATAGACTGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

6.14

Weight (kDa)

5.02

Isoelectric Point (pI)

43.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 98
AjuI GAANNNNNNNTTGG 2 cut(s) 131, 163
AluBI AGCT 1 cut(s) 53
AluI AGCT 1 cut(s) 53
ApeKI GCWGC 1 cut(s) 89
AspLEI GCGC 1 cut(s) 26
BbvI GCAGC 1 cut(s) 76
BccI CCATC 2 cut(s) 7, 74
BfaI CTAG 1 cut(s) 166
BfoI RGCGCY 1 cut(s) 27
BisI GCNGC 1 cut(s) 90
BlsI GCNGC 1 cut(s) 91
BmsI GCATC 2 cut(s) 52, 142
BpuEI CTTGAG 1 cut(s) 86
BseGI GGATG 2 cut(s) 18, 157
BseXI GCAGC 1 cut(s) 76
BstF5I GGATG 2 cut(s) 18, 157
BstH2I RGCGCY 1 cut(s) 27
BstHHI GCGC 1 cut(s) 26
BstV1I GCAGC 1 cut(s) 76
BtgZI GCGATG 1 cut(s) 52
BtsCI GGATG 2 cut(s) 18, 157
CfoI GCGC 1 cut(s) 26
CviJI RGCY 1 cut(s) 53
CviKI_1 RGCY 1 cut(s) 53
FaiI YATR 3 cut(s) 10, 125, 158
FalI AAGNNNNNCTT 4 cut(s) 42, 74, 131, 163
Fnu4HI GCNGC 1 cut(s) 90
FokI GGATG 2 cut(s) 25, 164
Fsp4HI GCNGC 1 cut(s) 90
FspBI CTAG 1 cut(s) 166
GlaI GCGC 1 cut(s) 25
GluI GCNGC 1 cut(s) 90
HaeII RGCGCY 1 cut(s) 27
HhaI GCGC 1 cut(s) 26
Hin6I GCGC 1 cut(s) 24
HinP1I GCGC 1 cut(s) 24
HinfI GANTC 1 cut(s) 83
HpyAV CCTTC 1 cut(s) 103
HspAI GCGC 1 cut(s) 24
Lsp1109I GCAGC 1 cut(s) 76
LweI GCATC 2 cut(s) 52, 142
MaeI CTAG 1 cut(s) 166
MnlI CCTC 2 cut(s) 82, 86
PfeI GAWTC 1 cut(s) 83
PkrI GCNGC 1 cut(s) 91
SatI GCNGC 1 cut(s) 90
SetI ASST 2 cut(s) 55, 60
SfaNI GCATC 2 cut(s) 52, 142
SgeI CNNG 4 cut(s) 71, 115, 130, 160
SmlI CTYRAG 1 cut(s) 101
SmoI CTYRAG 1 cut(s) 101
SspMI CTAG 1 cut(s) 166
TfiI GAWTC 1 cut(s) 83
TseI GCWGC 1 cut(s) 89
TspDTI ATGAA 1 cut(s) 140
XspI CTAG 1 cut(s) 166
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.