Rh7CG476900

Tetratricopeptide repeat protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Reverse (-)
64080204 .. 64085066
4863 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG476900.1

Sequence Viewer

Length: 180 bp
ATGGCACTATGGATGGAGAAAGTCGCCGAACCCCAAACCGAAAGCGAAAAAGCTGACCTTGATGCCATCGCCGCCTTCAAAGAATCTGCCACCTTCAAAGGTCCTCTCTTTCTCAACAAAGACATTACAAAAGAACTTTTGGATTTTGACAATGCTGCCATTACCCTATTAATGGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

59

Amino Acids

6.6

Weight (kDa)

4.39

Isoelectric Point (pI)

37.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 72
AfiI CCNNNNNNNGG 1 cut(s) 172
AgsI TTSAA 2 cut(s) 79, 97
AluBI AGCT 1 cut(s) 53
AluI AGCT 1 cut(s) 53
ApeKI GCWGC 1 cut(s) 155
AseI ATTAAT 1 cut(s) 170
AspS9I GGNCC 1 cut(s) 101
AvaII GGWCC 1 cut(s) 101
BbvI GCAGC 1 cut(s) 142
BccI CCATC 2 cut(s) 7, 74
BisI GCNGC 2 cut(s) 72, 156
BlsI GCNGC 2 cut(s) 73, 157
Bme18I GGWCC 1 cut(s) 101
BmgT120I GGNCC 1 cut(s) 101
BmsI GCATC 1 cut(s) 52
Bsc4I CCNNNNNNNGG 1 cut(s) 172
BseGI GGATG 1 cut(s) 18
BseLI CCNNNNNNNGG 1 cut(s) 172
BseXI GCAGC 1 cut(s) 142
BslI CCNNNNNNNGG 1 cut(s) 172
BspACI CCGC 1 cut(s) 72
BstF5I GGATG 1 cut(s) 18
BstMWI GCNNNNNNNGC 1 cut(s) 71
BstV1I GCAGC 1 cut(s) 142
BtgZI GCGATG 1 cut(s) 52
BtsCI GGATG 1 cut(s) 18
Cfr13I GGNCC 1 cut(s) 101
CviJI RGCY 1 cut(s) 53
CviKI_1 RGCY 1 cut(s) 53
Eco47I GGWCC 1 cut(s) 101
EcoO109I RGGNCCY 1 cut(s) 101
FaiI YATR 1 cut(s) 10
FalI AAGNNNNNCTT 2 cut(s) 42, 74
Fnu4HI GCNGC 2 cut(s) 72, 156
FokI GGATG 1 cut(s) 25
Fsp4HI GCNGC 2 cut(s) 72, 156
GluI GCNGC 2 cut(s) 72, 156
HinfI GANTC 1 cut(s) 83
HpyAV CCTTC 2 cut(s) 85, 103
HpyF10VI GCNNNNNNNGC 1 cut(s) 71
Lsp1109I GCAGC 1 cut(s) 142
LweI GCATC 1 cut(s) 52
MnlI CCTC 1 cut(s) 114
MseI TTAA 1 cut(s) 170
MwoI GCNNNNNNNGC 1 cut(s) 71
PfeI GAWTC 1 cut(s) 83
PkrI GCNGC 2 cut(s) 73, 157
PpuMI RGGWCCY 1 cut(s) 101
PshBI ATTAAT 1 cut(s) 170
Psp5II RGGWCCY 1 cut(s) 101
PspPI GGNCC 1 cut(s) 101
PspPPI RGGWCCY 1 cut(s) 101
SaqAI TTAA 1 cut(s) 170
SatI GCNGC 2 cut(s) 72, 156
Sau96I GGNCC 1 cut(s) 101
SetI ASST 4 cut(s) 55, 60, 95, 103
SfaNI GCATC 1 cut(s) 52
SgeI CNNG 1 cut(s) 71
SinI GGWCC 1 cut(s) 101
SsiI CCGC 1 cut(s) 72
TauI GCSGC 1 cut(s) 74
TfiI GAWTC 1 cut(s) 83
Tru1I TTAA 1 cut(s) 170
Tru9I TTAA 1 cut(s) 170
TseI GCWGC 1 cut(s) 155
VpaK11BI GGWCC 1 cut(s) 101
VspI ATTAAT 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.