Rh6BG107700

Tetratricopeptide repeat protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Reverse (-)
16731428 .. 16731697
270 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG107700.1

Sequence Viewer

Length: 195 bp
ATGGCACTATGGATGGAGAAAGTTGCCGAACCCCAAACCGAAAGCGAAAAAGCTGGCCTTGATGCCATCGCCGTCTTCAAAGAATCTGCTGCTATTGAATTCAAGGAGAAGGGCAACGAGTTTGTGAAAAAGGGTAAGAAGCATTACTCGGATGCCATAGACTGCTACACCAATCAATACCCAAGCTTTGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

7.28

Weight (kDa)

5.12

Isoelectric Point (pI)

38.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 98
AgsI TTSAA 3 cut(s) 79, 98, 103
AluBI AGCT 2 cut(s) 53, 186
AluI AGCT 2 cut(s) 53, 186
AoxI GGCC 1 cut(s) 55
ApeKI GCWGC 1 cut(s) 89
ApoI RAATTY 1 cut(s) 98
BbsI GAAGAC 1 cut(s) 67
BbvI GCAGC 1 cut(s) 76
BccI CCATC 2 cut(s) 7, 74
BceAI ACGGC 1 cut(s) 56
BisI GCNGC 1 cut(s) 90
BlsI GCNGC 1 cut(s) 91
BmsI GCATC 2 cut(s) 52, 142
BpiI GAAGAC 1 cut(s) 67
BseGI GGATG 2 cut(s) 18, 157
BseXI GCAGC 1 cut(s) 76
BshFI GGCC 1 cut(s) 57
BsnI GGCC 1 cut(s) 57
BspANI GGCC 1 cut(s) 57
BstC8I GCNNGC 1 cut(s) 55
BstF5I GGATG 2 cut(s) 18, 157
BstV1I GCAGC 1 cut(s) 76
BstV2I GAAGAC 1 cut(s) 67
BsuRI GGCC 1 cut(s) 57
BtgZI GCGATG 1 cut(s) 52
BtsCI GGATG 2 cut(s) 18, 157
Cac8I GCNNGC 1 cut(s) 55
CviJI RGCY 3 cut(s) 53, 57, 186
CviKI_1 RGCY 3 cut(s) 53, 57, 186
EcoRI GAATTC 1 cut(s) 98
FaiI YATR 2 cut(s) 10, 158
FalI AAGNNNNNCTT 2 cut(s) 42, 74
Fnu4HI GCNGC 1 cut(s) 90
FokI GGATG 2 cut(s) 25, 164
Fsp4HI GCNGC 1 cut(s) 90
GluI GCNGC 1 cut(s) 90
HaeIII GGCC 1 cut(s) 57
HindIII AAGCTT 1 cut(s) 184
HinfI GANTC 1 cut(s) 83
Hpy188I TCNGA 1 cut(s) 151
HpyAV CCTTC 1 cut(s) 103
LpnPI CCDG 1 cut(s) 39
Lsp1109I GCAGC 1 cut(s) 76
LweI GCATC 2 cut(s) 52, 142
MboII GAAGA 1 cut(s) 67
MluCI AATT 1 cut(s) 98
PfeI GAWTC 1 cut(s) 83
PkrI GCNGC 1 cut(s) 91
SatI GCNGC 1 cut(s) 90
SetI ASST 2 cut(s) 55, 188
SfaNI GCATC 2 cut(s) 52, 142
SgeI CNNG 5 cut(s) 66, 71, 115, 130, 160
Sse9I AATT 1 cut(s) 98
TasI AATT 1 cut(s) 98
TfiI GAWTC 1 cut(s) 83
TseI GCWGC 1 cut(s) 89
XapI RAATTY 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.