MD08G1125600.v1.1
MYB Family

At2g29880-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
OG0006437
Physical Location & Seq
Reverse (-)
11800562 .. 11801181
620 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1125600.v1.1.491

Sequence Viewer

Length: 525 bp
ATGGGAAGCAACTCTGGCTTTGGGTGGGATGCAAACAAAAAAAGATTTGTTGCTGATGACGAAGTTTGGGAAGAATACTTTAGGGCCTACCCAGACCAAAGAAGCATTTGTAAAAAATCTTGTGATGACTTTGAAGATTTGCAAATCATACTTGGGGATGCAACTGCTACTGGAAAACAGTCATTGGGATTGGGTGAGGAAACTGATGCAAGAACTTTTGTAATGGAAGGTGGAATAGAGGAAGATGAACAAGTTGGAATAGAGAACTTGTTTTACAATGAGGAAAATGGGGGCTTTGTACTAAATCAAAACCAAGCATCACACCAAACTTCATCATTCGATCAATCATCCCAATTCTTACCCACTCAGACCACTAGCTTAGAGATTCCCCCAGAAATCACCAATCATAGGAAACGAAACAGAACCCAATACCAGGGGAATACTAGATCATATGAGACCACTAATCAAGCTAGAATTAAGGAAAATATTTCACTTACTCTCGGTTCAATTGCCACTGACTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-bind_3

Protein Analysis

175

Amino Acids

19.66

Weight (kDa)

4.51

Isoelectric Point (pI)

53.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 300
AfiI CCNNNNNNNGG 2 cut(s) 408, 433
AgsI TTSAA 2 cut(s) 134, 507
AjnI CCWGG 1 cut(s) 432
AluBI AGCT 2 cut(s) 378, 470
AluI AGCT 2 cut(s) 378, 470
Alw26I GTCTC 1 cut(s) 449
AoxI GGCC 1 cut(s) 84
AspS9I GGNCC 1 cut(s) 84
AsuHPI GGTGA 2 cut(s) 206, 391
BciT130I CCWGG 1 cut(s) 434
BcoDI GTCTC 1 cut(s) 449
BfaI CTAG 3 cut(s) 375, 444, 471
Bme1390I CCNGG 1 cut(s) 434
BmgT120I GGNCC 1 cut(s) 84
BmrFI CCNGG 1 cut(s) 434
BmsI GCATC 4 cut(s) 19, 148, 196, 326
BsaI GGTCTC 1 cut(s) 449
BsaJI CCNNGG 1 cut(s) 433
Bsc4I CCNNNNNNNGG 2 cut(s) 408, 433
Bse1I ACTGG 1 cut(s) 175
BseBI CCWGG 1 cut(s) 434
BseDI CCNNGG 1 cut(s) 433
BseGI GGATG 3 cut(s) 34, 163, 347
BseLI CCNNNNNNNGG 2 cut(s) 408, 433
BseMII CTCAG 1 cut(s) 380
BseNI ACTGG 1 cut(s) 175
BshFI GGCC 1 cut(s) 86
BslI CCNNNNNNNGG 2 cut(s) 408, 433
BsmAI GTCTC 1 cut(s) 449
BsnI GGCC 1 cut(s) 86
Bso31I GGTCTC 1 cut(s) 449
Bsp143I GATC 2 cut(s) 340, 446
BspANI GGCC 1 cut(s) 86
BspCNI CTCAG 1 cut(s) 379
BspTNI GGTCTC 1 cut(s) 449
BsrI ACTGG 1 cut(s) 175
BssECI CCNNGG 1 cut(s) 433
BssMI GATC 2 cut(s) 340, 446
Bst2UI CCWGG 1 cut(s) 434
Bst4CI ACNGT 1 cut(s) 180
BstDEI CTNAG 2 cut(s) 366, 379
BstF5I GGATG 3 cut(s) 34, 163, 347
BstKTI GATC 2 cut(s) 343, 449
BstMAI GTCTC 1 cut(s) 449
BstMBI GATC 2 cut(s) 340, 446
BstMWI GCNNNNNNNGC 1 cut(s) 15
BstNI CCWGG 1 cut(s) 434
BstSCI CCNGG 1 cut(s) 432
BsuRI GGCC 1 cut(s) 86
BtsCI GGATG 3 cut(s) 34, 163, 347
BtsIMutI CAGTG 1 cut(s) 513
Cfr13I GGNCC 1 cut(s) 84
Csp6I GTAC 1 cut(s) 299
CviJI RGCY 5 cut(s) 18, 86, 294, 378, 470
CviKI_1 RGCY 5 cut(s) 18, 86, 294, 378, 470
CviQI GTAC 1 cut(s) 299
DdeI CTNAG 2 cut(s) 366, 379
DpnI GATC 2 cut(s) 342, 448
DpnII GATC 2 cut(s) 340, 446
Eco31I GGTCTC 1 cut(s) 449
EcoO109I RGGNCCY 1 cut(s) 84
EcoRII CCWGG 1 cut(s) 432
FaiI YATR 4 cut(s) 149, 408, 451, 453
FauNDI CATATG 1 cut(s) 451
FokI GGATG 3 cut(s) 41, 170, 334
FspBI CTAG 3 cut(s) 375, 444, 471
HaeIII GGCC 1 cut(s) 86
HinfI GANTC 1 cut(s) 385
HphI GGTGA 2 cut(s) 206, 391
Hpy188I TCNGA 1 cut(s) 369
HpyAV CCTTC 1 cut(s) 221
HpyCH4III ACNGT 1 cut(s) 180
HpyCH4V TGCA 4 cut(s) 32, 142, 161, 209
HpyF10VI GCNNNNNNNGC 1 cut(s) 15
HpyF3I CTNAG 2 cut(s) 366, 379
Kzo9I GATC 2 cut(s) 340, 446
LpnPI CCDG 5 cut(s) 105, 156, 405, 419, 446
LweI GCATC 4 cut(s) 19, 148, 196, 326
MaeI CTAG 3 cut(s) 375, 444, 471
MalI GATC 2 cut(s) 342, 448
MboI GATC 2 cut(s) 340, 446
MboII GAAGA 3 cut(s) 83, 146, 254
MfeI CAATTG 1 cut(s) 507
MluCI AATT 3 cut(s) 353, 474, 507
MmeI TCCRAC 1 cut(s) 235
MnlI CCTC 3 cut(s) 190, 232, 274
MseI TTAA 1 cut(s) 477
MspR9I CCNGG 1 cut(s) 434
MunI CAATTG 1 cut(s) 507
MvaI CCWGG 1 cut(s) 434
MwoI GCNNNNNNNGC 1 cut(s) 15
NdeI CATATG 1 cut(s) 451
NdeII GATC 2 cut(s) 340, 446
PfeI GAWTC 1 cut(s) 385
Psp6I CCWGG 1 cut(s) 432
PspGI CCWGG 1 cut(s) 432
PspPI GGNCC 1 cut(s) 84
PsrI GAACNNNNNNTAC 2 cut(s) 257, 289
RsaI GTAC 1 cut(s) 300
RsaNI GTAC 1 cut(s) 299
SaqAI TTAA 1 cut(s) 477
Sau3AI GATC 2 cut(s) 340, 446
Sau96I GGNCC 1 cut(s) 84
ScrFI CCNGG 1 cut(s) 434
SetI ASST 3 cut(s) 232, 380, 472
SfaNI GCATC 4 cut(s) 19, 148, 196, 326
Sse9I AATT 3 cut(s) 353, 474, 507
SspI AATATT 1 cut(s) 487
SspMI CTAG 3 cut(s) 375, 444, 471
StyD4I CCNGG 1 cut(s) 432
TaaI ACNGT 1 cut(s) 180
TaqI TCGA 1 cut(s) 339
TasI AATT 3 cut(s) 353, 474, 507
TatI WGTACW 1 cut(s) 298
TfiI GAWTC 1 cut(s) 385
Tru1I TTAA 1 cut(s) 477
Tru9I TTAA 1 cut(s) 477
TscAI CASTG 1 cut(s) 520
TspDTI ATGAA 2 cut(s) 261, 321
TspRI CASTG 1 cut(s) 520
XspI CTAG 3 cut(s) 375, 444, 471
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.