Prupe.4G156100_v2.0.a1
MYB Family

At2g29880-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
OG0006437
Physical Location & Seq
Reverse (-)
8948803 .. 8951138
2336 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G156100.1

Sequence Viewer

Length: 1005 bp
ATGGGAGATGCACGACAATTGCAAGTAAATGGAAAAGGGAAGGCCAAGAATGATTATAACAGTTGGAATATGGAAGAGAGCAAGATGTTGTTACAACTCATGGTCGATGCTGTGTCTCATGGATGGCGGAATCCTAATGGTGTGCTAAACAAGGCAACTGTAGAAGCTAAAATACTTCCAAAGATTAATGAAAAACTTAAGTGTCAAAAAAGTTATTCTCATTACCAGAGTCGGTTGAAATACTTTAAGAAAAAATATCAAAAGTATACCCAACTTGTCCATCATTGCTCTGGGTTTGAGTGGGACCCAATCAGAAAGAAATTCACTGGTGATGAAAAACTTTGGGAAGATTACTTTAAGTCCTATCCGAGCCACATAGGCCTTCGCACAGAAACTTGTGAGGACTATGAGGAATTGCAAATTGTATTTGGGAATGAAATTGCTATTGAGAGAAACTCGTTAGAATTGGGTGATGATATTGATGCAAGAATTGATTGGGTCGAAGATAGACATGTTGGAAAACAGGAGTTTGTTTATGATGATGGTAATAAGGCTTTTCTACCAAATGAAAAGGAACCATCACACCAAGATCCATCACCTGGACAATCTTCATCACCCTTACTCTTTCATGCCACTAGTCCGAAAGTTCCCTCAGAAAGCATCAACCAGAAGAAACGAACTAGAGCTGAGTATGAAGGGAATACTACCTCATTTGAGACCACCAATCAAGCTGGAATACTGGAAAAACTTTCTCTTAACATTGATTCAATTGCTACCAACTTTCAGAGAATCTGTAACCTATTGGAGAAAAGGGAGAAAGATAGAGAGAAAAGGAAAAGAGAGAACCAAAGTTGTATTTGGGTTGCTATCAAGGAGACCCCAAATTTGGATGAACGTGCTCGTTATAAAGCAGTTGCATTGCTTAATACTAAAACAAGAAGGGATGTATTTTTTAGTATGTCACTTGAAGAGCGCTCAGATTGGATAACCTACCTTTTGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-bind_3

Protein Analysis

335

Amino Acids

39.01

Weight (kDa)

8.38

Isoelectric Point (pI)

46.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 57, 906
AccB7I CCANNNNNTGG 1 cut(s) 599
AccI GTMKAC 1 cut(s) 266
AciI CCGC 1 cut(s) 127
AclWI GGATC 1 cut(s) 584
AcsI RAATTY 2 cut(s) 320, 883
AfeI AGCGCT 1 cut(s) 974
AfiI CCNNNNNNNGG 2 cut(s) 599, 886
AflII CTTAAG 1 cut(s) 197
AflIII ACRYGT 1 cut(s) 511
AgsI TTSAA 4 cut(s) 238, 768, 968, 1000
AhlI ACTAGT 1 cut(s) 635
AjnI CCWGG 1 cut(s) 598
AluBI AGCT 3 cut(s) 167, 686, 731
AluI AGCT 3 cut(s) 167, 686, 731
Alw21I GWGCWC 1 cut(s) 901
Alw26I GTCTC 3 cut(s) 120, 710, 869
AlwI GGATC 1 cut(s) 584
Aor51HI AGCGCT 1 cut(s) 974
AoxI GGCC 2 cut(s) 42, 379
ApoI RAATTY 2 cut(s) 320, 883
ArsI GACNNNNNNTTYG 2 cut(s) 868, 900
AseI ATTAAT 1 cut(s) 186
AspLEI GCGC 1 cut(s) 975
AspS9I GGNCC 1 cut(s) 304
AsuHPI GGTGA 4 cut(s) 341, 482, 588, 606
AvaII GGWCC 1 cut(s) 304
BarI GAAGNNNNNNTAC 2 cut(s) 156, 188
Bbv12I GWGCWC 1 cut(s) 901
BccI CCATC 5 cut(s) 117, 288, 536, 586, 601
BciT130I CCWGG 1 cut(s) 600
BcoDI GTCTC 3 cut(s) 120, 710, 869
BcuI ACTAGT 1 cut(s) 635
BfaI CTAG 2 cut(s) 636, 681
BfmI CTRYAG 1 cut(s) 159
BfoI RGCGCY 1 cut(s) 976
BfrI CTTAAG 1 cut(s) 197
BglI GCCNNNNNGGC 1 cut(s) 378
Bme1390I CCNGG 1 cut(s) 600
Bme18I GGWCC 1 cut(s) 304
BmgT120I GGNCC 1 cut(s) 304
BmiI GGNNCC 3 cut(s) 305, 306, 576
BmrFI CCNGG 1 cut(s) 600
BmsI GCATC 3 cut(s) 97, 472, 669
BplI GAGNNNNNCTC 2 cut(s) 440, 472
BsaI GGTCTC 2 cut(s) 710, 869
Bsc4I CCNNNNNNNGG 2 cut(s) 599, 886
Bse1I ACTGG 2 cut(s) 331, 744
Bse3DI GCAATG 2 cut(s) 283, 917
BseBI CCWGG 1 cut(s) 600
BseGI GGATG 3 cut(s) 128, 895, 949
BseLI CCNNNNNNNGG 2 cut(s) 599, 886
BseMI GCAATG 2 cut(s) 283, 917
BseMII CTCAG 3 cut(s) 666, 678, 990
BseNI ACTGG 2 cut(s) 331, 744
BshFI GGCC 2 cut(s) 44, 381
BsiHKAI GWGCWC 1 cut(s) 901
BslFI GGGAC 1 cut(s) 317
BslI CCNNNNNNNGG 2 cut(s) 599, 886
BsmAI GTCTC 3 cut(s) 120, 710, 869
BsmFI GGGAC 1 cut(s) 317
BsnI GGCC 2 cut(s) 44, 381
Bso31I GGTCTC 2 cut(s) 710, 869
Bsp1286I GDGCHC 1 cut(s) 901
Bsp143I GATC 1 cut(s) 589
BspACI CCGC 1 cut(s) 127
BspANI GGCC 2 cut(s) 44, 381
BspCNI CTCAG 3 cut(s) 665, 679, 989
BspLI GGNNCC 3 cut(s) 305, 306, 576
BspPI GGATC 1 cut(s) 584
BspQI GCTCTTC 1 cut(s) 963
BspTI CTTAAG 1 cut(s) 197
BspTNI GGTCTC 2 cut(s) 710, 869
BsrDI GCAATG 2 cut(s) 283, 917
BsrI ACTGG 2 cut(s) 331, 744
BssMI GATC 1 cut(s) 589
BssNAI GTATAC 1 cut(s) 267
Bst1107I GTATAC 1 cut(s) 267
Bst2UI CCWGG 1 cut(s) 600
Bst4CI ACNGT 2 cut(s) 62, 160
Bst6I CTCTTC 2 cut(s) 69, 963
BstAFI CTTAAG 1 cut(s) 197
BstDEI CTNAG 3 cut(s) 652, 687, 976
BstF5I GGATG 3 cut(s) 128, 895, 949
BstH2I RGCGCY 1 cut(s) 976
BstHHI GCGC 1 cut(s) 975
BstKTI GATC 1 cut(s) 592
BstMAI GTCTC 3 cut(s) 120, 710, 869
BstMBI GATC 1 cut(s) 589
BstMWI GCNNNNNNNGC 1 cut(s) 378
BstNI CCWGG 1 cut(s) 600
BstNSI RCATGY 1 cut(s) 515
BstSCI CCNGG 1 cut(s) 598
BstSFI CTRYAG 1 cut(s) 159
BstX2I RGATCY 1 cut(s) 589
BstYI RGATCY 1 cut(s) 589
BstZ17I GTATAC 1 cut(s) 267
BsuRI GGCC 2 cut(s) 44, 381
BtsCI GGATG 3 cut(s) 128, 895, 949
BtsIMutI CAGTG 1 cut(s) 324
CfoI GCGC 1 cut(s) 975
Cfr13I GGNCC 1 cut(s) 304
CviAII CATG 4 cut(s) 100, 119, 512, 629
CviJI RGCY 7 cut(s) 44, 167, 372, 381, 554, 686, 731
CviKI_1 RGCY 7 cut(s) 44, 167, 372, 381, 554, 686, 731
DdeI CTNAG 3 cut(s) 652, 687, 976
DpnI GATC 1 cut(s) 591
DpnII GATC 1 cut(s) 589
Eam1104I CTCTTC 2 cut(s) 69, 963
EarI CTCTTC 2 cut(s) 69, 963
EciI GGCGGA 1 cut(s) 142
Eco147I AGGCCT 1 cut(s) 381
Eco31I GGTCTC 2 cut(s) 710, 869
Eco47I GGWCC 1 cut(s) 304
Eco47III AGCGCT 1 cut(s) 974
EcoO109I RGGNCCY 1 cut(s) 304
EcoRII CCWGG 1 cut(s) 598
FaeI CATG 4 cut(s) 103, 122, 515, 632
FaqI GGGAC 1 cut(s) 317
FatI CATG 4 cut(s) 99, 118, 511, 628
FblI GTMKAC 1 cut(s) 266
FokI GGATG 3 cut(s) 135, 902, 956
FspBI CTAG 2 cut(s) 636, 681
GlaI GCGC 1 cut(s) 974
HaeII RGCGCY 1 cut(s) 976
HaeIII GGCC 2 cut(s) 44, 381
HhaI GCGC 1 cut(s) 975
Hin1II CATG 4 cut(s) 103, 122, 515, 632
Hin6I GCGC 1 cut(s) 973
HinP1I GCGC 1 cut(s) 973
HinfI GANTC 4 cut(s) 130, 229, 764, 789
HphI GGTGA 4 cut(s) 341, 482, 588, 606
Hpy166II GTNNAC 1 cut(s) 267
Hpy188I TCNGA 6 cut(s) 314, 369, 642, 655, 786, 979
Hpy8I GTNNAC 1 cut(s) 267
HpyAV CCTTC 4 cut(s) 34, 392, 689, 933
HpyCH4III ACNGT 2 cut(s) 62, 160
HpyCH4IV ACGT 1 cut(s) 895
HpyCH4V TGCA 5 cut(s) 11, 22, 418, 485, 917
HpyF10VI GCNNNNNNNGC 1 cut(s) 378
HpyF3I CTNAG 3 cut(s) 652, 687, 976
HpySE526I ACGT 1 cut(s) 895
Hsp92II CATG 4 cut(s) 103, 122, 515, 632
HspAI GCGC 1 cut(s) 973
KflI GGGWCCC 1 cut(s) 304
Kzo9I GATC 1 cut(s) 589
LguI GCTCTTC 1 cut(s) 963
LpnPI CCDG 9 cut(s) 239, 276, 312, 509, 585, 612, 680, 717, 725
LweI GCATC 3 cut(s) 97, 472, 669
MaeI CTAG 2 cut(s) 636, 681
MaeII ACGT 1 cut(s) 895
MaeIII GTNAC 3 cut(s) 90, 794, 960
MalI GATC 1 cut(s) 591
MboI GATC 1 cut(s) 589
MboII GAAGA 6 cut(s) 86, 359, 515, 600, 682, 980
MfeI CAATTG 2 cut(s) 17, 768
MflI RGATCY 1 cut(s) 589
MhlI GDGCHC 1 cut(s) 901
MluCI AATT 9 cut(s) 17, 320, 413, 420, 438, 464, 489, 768, 883
MlyI GAGTC 1 cut(s) 238
MmeI TCCRAC 2 cut(s) 44, 496
MnlI CCTC 4 cut(s) 394, 403, 661, 718
MseI TTAA 6 cut(s) 186, 198, 246, 357, 756, 924
MspCI CTTAAG 1 cut(s) 197
MspR9I CCNGG 1 cut(s) 600
MunI CAATTG 2 cut(s) 17, 768
MvaI CCWGG 1 cut(s) 600
MwoI GCNNNNNNNGC 1 cut(s) 378
NdeII GATC 1 cut(s) 589
NlaIII CATG 4 cut(s) 103, 122, 515, 632
NlaIV GGNNCC 3 cut(s) 305, 306, 576
NmuCI GTSAC 1 cut(s) 960
NspI RCATGY 1 cut(s) 515
PceI AGGCCT 1 cut(s) 381
PciI ACATGT 1 cut(s) 511
PciSI GCTCTTC 1 cut(s) 963
PfeI GAWTC 3 cut(s) 130, 764, 789
PflMI CCANNNNNTGG 1 cut(s) 599
PleI GAGTC 1 cut(s) 237
PpsI GAGTC 1 cut(s) 237
PpuMI RGGWCCY 1 cut(s) 304
PscI ACATGT 1 cut(s) 511
PshBI ATTAAT 1 cut(s) 186
PsiI TTATAA 2 cut(s) 57, 906
Psp5II RGGWCCY 1 cut(s) 304
Psp6I CCWGG 1 cut(s) 598
PspGI CCWGG 1 cut(s) 598
PspN4I GGNNCC 3 cut(s) 305, 306, 576
PspPI GGNCC 1 cut(s) 304
PspPPI RGGWCCY 1 cut(s) 304
PsuI RGATCY 1 cut(s) 589
SapI GCTCTTC 1 cut(s) 963
SaqAI TTAA 6 cut(s) 186, 198, 246, 357, 756, 924
Sau3AI GATC 1 cut(s) 589
Sau96I GGNCC 1 cut(s) 304
SchI GAGTC 1 cut(s) 238
ScrFI CCNGG 1 cut(s) 600
SduI GDGCHC 1 cut(s) 901
SetI ASST 9 cut(s) 169, 601, 688, 710, 733, 801, 898, 992, 996
SfaNI GCATC 3 cut(s) 97, 472, 669
SfcI CTRYAG 1 cut(s) 159
SinI GGWCC 1 cut(s) 304
SmlI CTYRAG 1 cut(s) 197
SmoI CTYRAG 1 cut(s) 197
SpeI ACTAGT 1 cut(s) 635
Sse9I AATT 9 cut(s) 17, 320, 413, 420, 438, 464, 489, 768, 883
SseBI AGGCCT 1 cut(s) 381
SsiI CCGC 1 cut(s) 127
SspMI CTAG 2 cut(s) 636, 681
StuI AGGCCT 1 cut(s) 381
StyD4I CCNGG 1 cut(s) 598
TaaI ACNGT 2 cut(s) 62, 160
TaiI ACGT 1 cut(s) 898
TaqI TCGA 2 cut(s) 105, 501
TasI AATT 9 cut(s) 17, 320, 413, 420, 438, 464, 489, 768, 883
TfiI GAWTC 3 cut(s) 130, 764, 789
Tru1I TTAA 6 cut(s) 186, 198, 246, 357, 756, 924
Tru9I TTAA 6 cut(s) 186, 198, 246, 357, 756, 924
TscAI CASTG 1 cut(s) 331
TseFI GTSAC 1 cut(s) 960
Tsp45I GTSAC 1 cut(s) 960
TspDTI ATGAA 8 cut(s) 204, 348, 450, 582, 600, 617, 708, 906
TspRI CASTG 1 cut(s) 331
Van91I CCANNNNNTGG 1 cut(s) 599
Vha464I CTTAAG 1 cut(s) 197
VpaK11BI GGWCC 1 cut(s) 304
VspI ATTAAT 1 cut(s) 186
XapI RAATTY 2 cut(s) 320, 883
XceI RCATGY 1 cut(s) 515
XcmI CCANNNNNNNNNTGG 1 cut(s) 287
XmiI GTMKAC 1 cut(s) 266
XspI CTAG 2 cut(s) 636, 681
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.