Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp07

Orthogroup ID

OG0006437

Physical Location & Seq

Genomic Coordinates Reverse (-)

13418166 .. 13418853

Gene Structure 688 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.7G105100.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 540 bp

ATGTTGTTGCAACTCATGGTTGATGCTGCAAGCCGTGGATGGCGTGATGCTAATGGAATGCTAAGCAAGGCAACTGTAGAAACCAAAATACTCCCCAAGATTAATGAAAAACTTAGAATACAAAAATATTCACAGCTTCTCCGTCACAGCTCTGGGTTTAGGTGGGATCCAACCACAAAGAAATTCACTACTCTTGAAGAAGTTTGGAAAGACTACTTTAAGTCCCACCCAAAAGACACAAGTATTCAAACAAAAACTTGTGAAGGCTATGAGGATCTGCAAATTGTAATTGGGAATGCAACTGCTATTGGAAGAAACTCATTAAGATTGGGTGATGATACTGATGCAAGAACTTTTAGGGCGGAAGATAGACATGTTGGAATAGAGGACTTTGTCTTTGATGATGAAAGTCAGGCTTTTATACCAAATCATAATGAACCACCACACCAAGATCCACCACTTGGACATTCTTCTTCATCCTTCCCCTTTCAGGCCACTAATTGTAAAGGTCCCTTAGAAAGCTCAAGCCAGAAAAAATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Myb_DNA-bind_3

Protein Analysis

180

Amino Acids

20.31

Weight (kDa)

6.59

Isoelectric Point (pI)

43.74

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006437)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G30140 AT1G30140 AT2G29880 AT5G27260
malus_domestica	MD03G1206200.v1.1 MD03G1212300.v1.1 MD05G1104000.v1.1 MD05G1188000.v1.1 MD06G1083900.v1.1 MD08G1125600.v1.1 MD12G1017200.v1.1 MD16G1269500.v1.1
prunus_persica	Prupe.1G130600_v2.0.a1 Prupe.1G170700_v2.0.a1 Prupe.1G229800_v2.0.a1 Prupe.2G168600_v2.0.a1 Prupe.3G122800_v2.0.a1 Prupe.4G156100_v2.0.a1 Prupe.4G168300_v2.0.a1 Prupe.6G020000_v2.0.a1 Prupe.6G133700_v2.0.a1 Prupe.6G164800_v2.0.a1 Prupe.7G073100_v2.0.a1 Prupe.7G105100_v2.0.a1
pyrus_communis	pycom02g17640 pycom08g12750

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	461
AciI	CCGC	1 cut(s)	362
AclWI	GGATC	4 cut(s)	161, 174, 282, 446
AcsI	RAATTY	1 cut(s)	182
AfiI	CCNNNNNNNGG	2 cut(s)	461, 490
AflIII	ACRYGT	1 cut(s)	373
AgsI	TTSAA	2 cut(s)	197, 248
AluBI	AGCT	3 cut(s)	136, 150, 522
AluI	AGCT	3 cut(s)	136, 150, 522
AlwI	GGATC	4 cut(s)	161, 174, 282, 446
AoxI	GGCC	1 cut(s)	492
ApeKI	GCWGC	1 cut(s)	26
ApoI	RAATTY	1 cut(s)	182
ArsI	GACNNNNNNTTYG	2 cut(s)	380, 412
AseI	ATTAAT	1 cut(s)	102
AspS9I	GGNCC	1 cut(s)	509
AsuHPI	GGTGA	1 cut(s)	344
AvaII	GGWCC	1 cut(s)	509
BamHI	GGATCC	1 cut(s)	166
BbvI	GCAGC	1 cut(s)	13
BccI	CCATC	1 cut(s)	33
BceAI	ACGGC	1 cut(s)	18
BfmI	CTRYAG	1 cut(s)	75
BisI	GCNGC	1 cut(s)	27
BlpI	GCTNAGC	1 cut(s)	62
BlsI	GCNGC	1 cut(s)	28
Bme18I	GGWCC	1 cut(s)	509
BmgT120I	GGNCC	1 cut(s)	509
BmiI	GGNNCC	2 cut(s)	168, 511
BmsI	GCATC	3 cut(s)	13, 37, 334
Bpu1102I	GCTNAGC	1 cut(s)	62
BpuEI	CTTGAG	1 cut(s)	508
BsaJI	CCNNGG	1 cut(s)	34
BsaXI	ACNNNNNCTCC	2 cut(s)	123, 153
Bsc4I	CCNNNNNNNGG	2 cut(s)	461, 490
BseDI	CCNNGG	1 cut(s)	34
BseGI	GGATG	2 cut(s)	44, 476
BseLI	CCNNNNNNNGG	2 cut(s)	461, 490
BseXI	GCAGC	1 cut(s)	13
BshFI	GGCC	1 cut(s)	494
BslFI	GGGAC	2 cut(s)	208, 495
BslI	CCNNNNNNNGG	2 cut(s)	461, 490
BsmFI	GGGAC	2 cut(s)	208, 495
BsmI	GAATGC	2 cut(s)	63, 301
BsnI	GGCC	1 cut(s)	494
Bsp143I	GATC	3 cut(s)	166, 274, 451
Bsp1720I	GCTNAGC	1 cut(s)	62
BspACI	CCGC	1 cut(s)	362
BspANI	GGCC	1 cut(s)	494
BspLI	GGNNCC	2 cut(s)	168, 511
BspPI	GGATC	4 cut(s)	161, 174, 282, 446
BssECI	CCNNGG	1 cut(s)	34
BssMI	GATC	3 cut(s)	166, 274, 451
Bst4CI	ACNGT	1 cut(s)	76
BstC8I	GCNNGC	1 cut(s)	31
BstDEI	CTNAG	3 cut(s)	62, 113, 514
BstDSI	CCRYGG	1 cut(s)	34
BstF5I	GGATG	2 cut(s)	44, 476
BstKTI	GATC	3 cut(s)	169, 277, 454
BstMBI	GATC	3 cut(s)	166, 274, 451
BstNSI	RCATGY	1 cut(s)	377
BstSFI	CTRYAG	1 cut(s)	75
BstV1I	GCAGC	1 cut(s)	13
BstX2I	RGATCY	3 cut(s)	166, 274, 451
BstYI	RGATCY	3 cut(s)	166, 274, 451
BsuRI	GGCC	1 cut(s)	494
BtgI	CCRYGG	1 cut(s)	34
BtsCI	GGATG	2 cut(s)	44, 476
Cac8I	GCNNGC	1 cut(s)	31
Cfr13I	GGNCC	1 cut(s)	509
CviAII	CATG	2 cut(s)	16, 374
CviJI	RGCY	8 cut(s)	33, 136, 150, 267, 416, 494, 522, 528
CviKI_1	RGCY	8 cut(s)	33, 136, 150, 267, 416, 494, 522, 528
DdeI	CTNAG	3 cut(s)	62, 113, 514
DpnI	GATC	3 cut(s)	168, 276, 453
DpnII	GATC	3 cut(s)	166, 274, 451
EciI	GGCGGA	1 cut(s)	377
Eco47I	GGWCC	1 cut(s)	509
EcoO109I	RGGNCCY	1 cut(s)	509
FaeI	CATG	2 cut(s)	19, 377
FaiI	YATR	5 cut(s)	17, 270, 375, 422, 432
FalI	AAGNNNNNCTT	2 cut(s)	400, 432
FaqI	GGGAC	2 cut(s)	208, 495
FatI	CATG	2 cut(s)	15, 373
Fnu4HI	GCNGC	1 cut(s)	27
FokI	GGATG	2 cut(s)	51, 463
Fsp4HI	GCNGC	1 cut(s)	27
GluI	GCNGC	1 cut(s)	27
HaeIII	GGCC	1 cut(s)	494
Hin1II	CATG	2 cut(s)	19, 377
HphI	GGTGA	1 cut(s)	344
Hpy188III	TCNNGA	1 cut(s)	194
HpyAV	CCTTC	2 cut(s)	257, 490
HpyCH4III	ACNGT	1 cut(s)	76
HpyCH4V	TGCA	5 cut(s)	10, 29, 280, 299, 347
HpyF3I	CTNAG	3 cut(s)	62, 113, 514
Hsp92II	CATG	2 cut(s)	19, 377
Kzo9I	GATC	3 cut(s)	166, 274, 451
LpnPI	CCDG	3 cut(s)	138, 398, 476
Lsp1109I	GCAGC	1 cut(s)	13
LweI	GCATC	3 cut(s)	13, 37, 334
MaeIII	GTNAC	1 cut(s)	143
MalI	GATC	3 cut(s)	168, 276, 453
MboI	GATC	3 cut(s)	166, 274, 451
MboII	GAAGA	5 cut(s)	209, 324, 377, 462, 465
MflI	RGATCY	3 cut(s)	166, 274, 451
MluCI	AATT	4 cut(s)	182, 282, 288, 499
MmeI	TCCRAC	2 cut(s)	194, 358
MnlI	CCTC	2 cut(s)	265, 379
MseI	TTAA	3 cut(s)	102, 219, 323
Mva1269I	GAATGC	2 cut(s)	63, 301
NdeII	GATC	3 cut(s)	166, 274, 451
NlaIII	CATG	2 cut(s)	19, 377
NlaIV	GGNNCC	2 cut(s)	168, 511
NmuCI	GTSAC	1 cut(s)	143
NspI	RCATGY	1 cut(s)	377
PciI	ACATGT	1 cut(s)	373
PctI	GAATGC	2 cut(s)	63, 301
PflFI	GACNNNGTC	1 cut(s)	392
PflMI	CCANNNNNTGG	1 cut(s)	461
PkrI	GCNGC	1 cut(s)	28
PpuMI	RGGWCCY	1 cut(s)	509
PscI	ACATGT	1 cut(s)	373
PshBI	ATTAAT	1 cut(s)	102
Psp5II	RGGWCCY	1 cut(s)	509
PspN4I	GGNNCC	2 cut(s)	168, 511
PspPI	GGNCC	1 cut(s)	509
PspPPI	RGGWCCY	1 cut(s)	509
PsuI	RGATCY	3 cut(s)	166, 274, 451
PsyI	GACNNNGTC	1 cut(s)	392
SaqAI	TTAA	3 cut(s)	102, 219, 323
SatI	GCNGC	1 cut(s)	27
Sau3AI	GATC	3 cut(s)	166, 274, 451
Sau96I	GGNCC	1 cut(s)	509
SetI	ASST	5 cut(s)	138, 152, 164, 511, 524
SfaNI	GCATC	3 cut(s)	13, 37, 334
SfcI	CTRYAG	1 cut(s)	75
SinI	GGWCC	1 cut(s)	509
SmlI	CTYRAG	1 cut(s)	523
SmoI	CTYRAG	1 cut(s)	523
Sse9I	AATT	4 cut(s)	182, 282, 288, 499
SsiI	CCGC	1 cut(s)	362
SspI	AATATT	1 cut(s)	128
TaaI	ACNGT	1 cut(s)	76
TasI	AATT	4 cut(s)	182, 282, 288, 499
Tru1I	TTAA	3 cut(s)	102, 219, 323
Tru9I	TTAA	3 cut(s)	102, 219, 323
TseFI	GTSAC	1 cut(s)	143
TseI	GCWGC	1 cut(s)	26
Tsp45I	GTSAC	1 cut(s)	143
TspDTI	ATGAA	4 cut(s)	120, 420, 450, 465
TspGWI	ACGGA	1 cut(s)	131
Tth111I	GACNNNGTC	1 cut(s)	392
Van91I	CCANNNNNTGG	1 cut(s)	461
VpaK11BI	GGWCC	1 cut(s)	509
VspI	ATTAAT	1 cut(s)	102
XapI	RAATTY	1 cut(s)	182
XceI	RCATGY	1 cut(s)	377

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.