Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp03

Orthogroup ID

OG0006437

Physical Location & Seq

Genomic Coordinates Forward (+)

10964399 .. 10964944

Gene Structure 546 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.3G122800.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 399 bp

ATGGTTGATTCTGCATCTCATGGATGGTGTGTTGCTAATGGCATGCTAAGCAAGGCAATTGTAGAAACCAAAATACTTCCCAAGATTAATGAAAAACTTAGATGTCACAAAACCTATTCTCGATACCAGAGTCACTCTAGGTTTGGGTGGGATCCAACCACAAAGAAATTTACTGCTCCTGAAGAAGTTTGGAAAGACTACTTTAAGTCCCACCCAAAACACACAAGTATTCAAACAAAAACTTGTGAGGACTATGAGGATCTGCAAATTGTAATTGGGAATGCAATAACTATTGGAAGAAACACATTAGGATTGGGTGATGATACTGATGCAAGAAATTTTAGGGTGGAAGATAGACATGTTGGAATAAAGGACTTTATTTTTTATGATGAAAGTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DDE_Tnp_4 Myb_DNA-bind_3

Protein Analysis

133

Amino Acids

15.23

Weight (kDa)

7.01

Isoelectric Point (pI)

32.73

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006437)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G30140 AT1G30140 AT2G29880 AT5G27260
malus_domestica	MD03G1206200.v1.1 MD03G1212300.v1.1 MD05G1104000.v1.1 MD05G1188000.v1.1 MD06G1083900.v1.1 MD08G1125600.v1.1 MD12G1017200.v1.1 MD16G1269500.v1.1
prunus_persica	Prupe.1G130600_v2.0.a1 Prupe.1G170700_v2.0.a1 Prupe.1G229800_v2.0.a1 Prupe.2G168600_v2.0.a1 Prupe.3G122800_v2.0.a1 Prupe.4G156100_v2.0.a1 Prupe.4G168300_v2.0.a1 Prupe.6G020000_v2.0.a1 Prupe.6G133700_v2.0.a1 Prupe.6G164800_v2.0.a1 Prupe.7G073100_v2.0.a1 Prupe.7G105100_v2.0.a1
pyrus_communis	pycom02g17640 pycom08g12750

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	3 cut(s)	146, 159, 267
AcsI	RAATTY	2 cut(s)	167, 337
AcuI	CTGAAG	1 cut(s)	201
AflIII	ACRYGT	1 cut(s)	358
AgsI	TTSAA	1 cut(s)	233
AlwI	GGATC	3 cut(s)	146, 159, 267
ApoI	RAATTY	2 cut(s)	167, 337
AseI	ATTAAT	1 cut(s)	87
AsuHPI	GGTGA	1 cut(s)	329
BaeI	ACNNNNGTAYC	2 cut(s)	115, 148
BamHI	GGATCC	1 cut(s)	151
BccI	CCATC	1 cut(s)	18
BfaI	CTAG	1 cut(s)	138
BlpI	GCTNAGC	1 cut(s)	47
BmiI	GGNNCC	1 cut(s)	153
BmsI	GCATC	2 cut(s)	23, 319
Bpu1102I	GCTNAGC	1 cut(s)	47
BseGI	GGATG	1 cut(s)	29
BslFI	GGGAC	1 cut(s)	193
BsmFI	GGGAC	1 cut(s)	193
BsmI	GAATGC	1 cut(s)	286
Bsp143I	GATC	2 cut(s)	151, 259
Bsp1720I	GCTNAGC	1 cut(s)	47
BspLI	GGNNCC	1 cut(s)	153
BspPI	GGATC	3 cut(s)	146, 159, 267
BssMI	GATC	2 cut(s)	151, 259
BstC8I	GCNNGC	1 cut(s)	44
BstDEI	CTNAG	2 cut(s)	47, 98
BstF5I	GGATG	1 cut(s)	29
BstKTI	GATC	2 cut(s)	154, 262
BstMBI	GATC	2 cut(s)	151, 259
BstMWI	GCNNNNNNNGC	1 cut(s)	48
BstNSI	RCATGY	2 cut(s)	46, 362
BstX2I	RGATCY	2 cut(s)	151, 259
BstYI	RGATCY	2 cut(s)	151, 259
BtsCI	GGATG	1 cut(s)	29
Cac8I	GCNNGC	1 cut(s)	44
CviAII	CATG	3 cut(s)	20, 43, 359
DdeI	CTNAG	2 cut(s)	47, 98
DpnI	GATC	2 cut(s)	153, 261
DpnII	GATC	2 cut(s)	151, 259
Eco57I	CTGAAG	1 cut(s)	201
FaeI	CATG	3 cut(s)	23, 46, 362
FaiI	YATR	5 cut(s)	21, 44, 255, 360, 387
FaqI	GGGAC	1 cut(s)	193
FatI	CATG	3 cut(s)	19, 42, 358
FokI	GGATG	1 cut(s)	36
FspBI	CTAG	1 cut(s)	138
Hin1II	CATG	3 cut(s)	23, 46, 362
HinfI	GANTC	2 cut(s)	8, 130
HphI	GGTGA	1 cut(s)	329
Hpy188III	TCNNGA	2 cut(s)	120, 179
HpyCH4V	TGCA	4 cut(s)	14, 265, 284, 332
HpyF10VI	GCNNNNNNNGC	1 cut(s)	48
HpyF3I	CTNAG	2 cut(s)	47, 98
Hsp92II	CATG	3 cut(s)	23, 46, 362
Kzo9I	GATC	2 cut(s)	151, 259
LmnI	GCTCC	1 cut(s)	181
LpnPI	CCDG	2 cut(s)	140, 192
LweI	GCATC	2 cut(s)	23, 319
MaeI	CTAG	1 cut(s)	138
MaeIII	GTNAC	2 cut(s)	104, 131
MalI	GATC	2 cut(s)	153, 261
MboI	GATC	2 cut(s)	151, 259
MboII	GAAGA	3 cut(s)	194, 309, 362
MfeI	CAATTG	1 cut(s)	57
MflI	RGATCY	2 cut(s)	151, 259
MluCI	AATT	5 cut(s)	57, 167, 267, 273, 337
MlyI	GAGTC	1 cut(s)	139
MmeI	TCCRAC	2 cut(s)	179, 343
MnlI	CCTC	2 cut(s)	241, 250
MseI	TTAA	2 cut(s)	87, 204
MunI	CAATTG	1 cut(s)	57
Mva1269I	GAATGC	1 cut(s)	286
MwoI	GCNNNNNNNGC	1 cut(s)	48
NdeII	GATC	2 cut(s)	151, 259
NlaIII	CATG	3 cut(s)	23, 46, 362
NlaIV	GGNNCC	1 cut(s)	153
NmuCI	GTSAC	2 cut(s)	104, 131
NspI	RCATGY	2 cut(s)	46, 362
PaeI	GCATGC	1 cut(s)	46
PciI	ACATGT	1 cut(s)	358
PctI	GAATGC	1 cut(s)	286
PfeI	GAWTC	1 cut(s)	8
PleI	GAGTC	1 cut(s)	138
PpsI	GAGTC	1 cut(s)	138
PscI	ACATGT	1 cut(s)	358
PshBI	ATTAAT	1 cut(s)	87
PspN4I	GGNNCC	1 cut(s)	153
PsuI	RGATCY	2 cut(s)	151, 259
SaqAI	TTAA	2 cut(s)	87, 204
Sau3AI	GATC	2 cut(s)	151, 259
SchI	GAGTC	1 cut(s)	139
SetI	ASST	2 cut(s)	116, 143
SfaNI	GCATC	2 cut(s)	23, 319
SphI	GCATGC	1 cut(s)	46
Sse9I	AATT	5 cut(s)	57, 167, 267, 273, 337
SspMI	CTAG	1 cut(s)	138
TaqI	TCGA	1 cut(s)	121
TasI	AATT	5 cut(s)	57, 167, 267, 273, 337
TfiI	GAWTC	1 cut(s)	8
Tru1I	TTAA	2 cut(s)	87, 204
Tru9I	TTAA	2 cut(s)	87, 204
TseFI	GTSAC	2 cut(s)	104, 131
Tsp45I	GTSAC	2 cut(s)	104, 131
TspDTI	ATGAA	1 cut(s)	105
VspI	ATTAAT	1 cut(s)	87
XapI	RAATTY	2 cut(s)	167, 337
XceI	RCATGY	2 cut(s)	46, 362
XspI	CTAG	1 cut(s)	138

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.