Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr8

Orthogroup ID

OG0006437

Physical Location & Seq

Genomic Coordinates Reverse (-)

11318002 .. 11319011

Gene Structure 1010 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom08g12750.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 687 bp

ATGGGAGATTTACAACAAGAAAAGGGAAAAGGAAACTATAATCAATGGTTTGTGGAAGAGAGCAACATGTTGTTACAACTACTTGTTGAGGCCGTAAAAAATGGATGGTGTGATGCTAATGGCATAATAAGCAATCAAGGTGTTCGCAAAGAGAGATTTGTGGACTATGAAGATTTGATGACTGTATTTGGCGATGGAACAACTAAAGGAAATAACTCAATTAGACTGGGCAATGATACTGATGGCATAACATATAGAGTCAAAGAAAGTAGGCCAATTAAAGTAAACGAATTCCCTCCACTTGATGAAAGCTTCAAGCAACTTGATCCATTAGTCCAAACACCATCCTATGCATCATCTTTCCTAGATGCAAATTTGGAGGGTCCCGCTCCAACACCCATGCAAAAACCACTCCCAAAGAAAAGATCTCTACCTGAGTCTGAGCTAAAATCAAATGGGACCACCCCTCACATCGTTCTTATAGAAAAAGTTTCCCTTGGAGTGGGTTCGATTGCTGCAATTGCCACTGAAATTCAAGGAATTCATAGCATAATGTTGAAAAGAGAAAAAGATAGAGAAAAAAGGAAAATGAGAAAAAAGAAGAAGAGAAAAACAACTATGTTTGGGATGCTATCAAAGAGAATTCAAATTTGGATGCACCTATTCGTTACAAAGCAATTACACTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Myb_DNA-bind_3

Protein Analysis

229

Amino Acids

25.87

Weight (kDa)

9.54

Isoelectric Point (pI)

39.68

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006437)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G30140 AT1G30140 AT2G29880 AT5G27260
malus_domestica	MD03G1206200.v1.1 MD03G1212300.v1.1 MD05G1104000.v1.1 MD05G1188000.v1.1 MD06G1083900.v1.1 MD08G1125600.v1.1 MD12G1017200.v1.1 MD16G1269500.v1.1
prunus_persica	Prupe.1G130600_v2.0.a1 Prupe.1G170700_v2.0.a1 Prupe.1G229800_v2.0.a1 Prupe.2G168600_v2.0.a1 Prupe.3G122800_v2.0.a1 Prupe.4G156100_v2.0.a1 Prupe.4G168300_v2.0.a1 Prupe.6G020000_v2.0.a1 Prupe.6G133700_v2.0.a1 Prupe.6G164800_v2.0.a1 Prupe.7G073100_v2.0.a1 Prupe.7G105100_v2.0.a1
pyrus_communis	pycom02g17640 pycom08g12750

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	389
AciI	CCGC	1 cut(s)	387
AclWI	GGATC	1 cut(s)	320
AcsI	RAATTY	6 cut(s)	290, 373, 531, 540, 642, 648
AfiI	CCNNNNNNNGG	1 cut(s)	502
AflIII	ACRYGT	1 cut(s)	66
AgsI	TTSAA	4 cut(s)	316, 536, 559, 647
AjuI	GAANNNNNNNTTGG	2 cut(s)	634, 666
AluBI	AGCT	2 cut(s)	312, 445
AluI	AGCT	2 cut(s)	312, 445
AlwI	GGATC	1 cut(s)	320
AoxI	GGCC	2 cut(s)	90, 272
ApeKI	GCWGC	1 cut(s)	515
ApoI	RAATTY	6 cut(s)	290, 373, 531, 540, 642, 648
AspS9I	GGNCC	2 cut(s)	383, 459
AvaII	GGWCC	2 cut(s)	383, 459
BbvI	GCAGC	1 cut(s)	502
BccI	CCATC	4 cut(s)	99, 188, 236, 352
BceAI	ACGGC	1 cut(s)	77
BfaI	CTAG	2 cut(s)	365, 685
BglII	AGATCT	1 cut(s)	425
BisI	GCNGC	1 cut(s)	516
BlsI	GCNGC	1 cut(s)	517
Bme18I	GGWCC	2 cut(s)	383, 459
BmgT120I	GGNCC	2 cut(s)	383, 459
BmiI	GGNNCC	3 cut(s)	384, 385, 460
BmrI	ACTGGG	1 cut(s)	236
BmsI	GCATC	5 cut(s)	103, 358, 362, 618, 645
BmuI	ACTGGG	1 cut(s)	236
BsaJI	CCNNGG	1 cut(s)	496
Bsc4I	CCNNNNNNNGG	1 cut(s)	502
Bse1I	ACTGG	1 cut(s)	231
Bse3DI	GCAATG	1 cut(s)	238
BseDI	CCNNGG	1 cut(s)	496
BseGI	GGATG	4 cut(s)	110, 344, 633, 660
BseLI	CCNNNNNNNGG	1 cut(s)	502
BseMI	GCAATG	1 cut(s)	238
BseMII	CTCAG	2 cut(s)	426, 432
BseNI	ACTGG	1 cut(s)	231
BseXI	GCAGC	1 cut(s)	502
BshFI	GGCC	2 cut(s)	92, 274
BslFI	GGGAC	2 cut(s)	369, 472
BslI	CCNNNNNNNGG	1 cut(s)	502
BsmFI	GGGAC	2 cut(s)	369, 472
BsnI	GGCC	2 cut(s)	92, 274
Bsp143I	GATC	2 cut(s)	325, 425
BspACI	CCGC	1 cut(s)	387
BspANI	GGCC	2 cut(s)	92, 274
BspCNI	CTCAG	2 cut(s)	427, 433
BspLI	GGNNCC	3 cut(s)	384, 385, 460
BspPI	GGATC	1 cut(s)	320
BsrBI	CCGCTC	1 cut(s)	389
BsrDI	GCAATG	1 cut(s)	238
BsrI	ACTGG	1 cut(s)	231
BssECI	CCNNGG	1 cut(s)	496
BssMI	GATC	2 cut(s)	325, 425
BssT1I	CCWWGG	1 cut(s)	496
Bst4CI	ACNGT	1 cut(s)	184
Bst6I	CTCTTC	2 cut(s)	51, 599
BstDEI	CTNAG	2 cut(s)	435, 441
BstF5I	GGATG	4 cut(s)	110, 344, 633, 660
BstKTI	GATC	2 cut(s)	328, 428
BstMBI	GATC	2 cut(s)	325, 425
BstMWI	GCNNNNNNNGC	2 cut(s)	129, 521
BstNSI	RCATGY	1 cut(s)	70
BstV1I	GCAGC	1 cut(s)	502
BstX2I	RGATCY	1 cut(s)	425
BstYI	RGATCY	1 cut(s)	425
BsuRI	GGCC	2 cut(s)	92, 274
BtgZI	GCGATG	1 cut(s)	207
BtsCI	GGATG	4 cut(s)	110, 344, 633, 660
BtsIMutI	CAGTG	1 cut(s)	525
Cfr13I	GGNCC	2 cut(s)	383, 459
CviAII	CATG	2 cut(s)	67, 400
CviJI	RGCY	4 cut(s)	92, 274, 312, 445
CviKI_1	RGCY	4 cut(s)	92, 274, 312, 445
DdeI	CTNAG	2 cut(s)	435, 441
DpnI	GATC	2 cut(s)	327, 427
DpnII	GATC	2 cut(s)	325, 425
Eam1104I	CTCTTC	2 cut(s)	51, 599
EarI	CTCTTC	2 cut(s)	51, 599
Eco130I	CCWWGG	1 cut(s)	496
Eco47I	GGWCC	2 cut(s)	383, 459
EcoO109I	RGGNCCY	1 cut(s)	383
EcoRI	GAATTC	3 cut(s)	290, 540, 642
EcoT14I	CCWWGG	1 cut(s)	496
EcoT22I	ATGCAT	1 cut(s)	355
ErhI	CCWWGG	1 cut(s)	496
FaeI	CATG	2 cut(s)	70, 403
FalI	AAGNNNNNCTT	2 cut(s)	480, 512
FaqI	GGGAC	2 cut(s)	369, 472
FatI	CATG	2 cut(s)	66, 399
FauI	CCCGC	1 cut(s)	394
Fnu4HI	GCNGC	1 cut(s)	516
FokI	GGATG	4 cut(s)	117, 331, 640, 667
Fsp4HI	GCNGC	1 cut(s)	516
FspBI	CTAG	2 cut(s)	365, 685
GluI	GCNGC	1 cut(s)	516
HaeIII	GGCC	2 cut(s)	92, 274
Hin1II	CATG	2 cut(s)	70, 403
HindIII	AAGCTT	1 cut(s)	310
HinfI	GANTC	2 cut(s)	258, 437
Hpy166II	GTNNAC	2 cut(s)	163, 286
Hpy188I	TCNGA	1 cut(s)	442
Hpy8I	GTNNAC	2 cut(s)	163, 286
HpyCH4III	ACNGT	1 cut(s)	184
HpyCH4V	TGCA	5 cut(s)	353, 371, 403, 518, 658
HpyF10VI	GCNNNNNNNGC	2 cut(s)	129, 521
HpyF3I	CTNAG	2 cut(s)	435, 441
Hsp92II	CATG	2 cut(s)	70, 403
KflI	GGGWCCC	1 cut(s)	383
Kzo9I	GATC	2 cut(s)	325, 425
LmnI	GCTCC	1 cut(s)	394
LpnPI	CCDG	2 cut(s)	212, 447
Lsp1109I	GCAGC	1 cut(s)	502
LweI	GCATC	5 cut(s)	103, 358, 362, 618, 645
MaeI	CTAG	2 cut(s)	365, 685
MaeIII	GTNAC	2 cut(s)	72, 667
MalI	GATC	2 cut(s)	327, 427
MbiI	CCGCTC	1 cut(s)	389
MboI	GATC	2 cut(s)	325, 425
MboII	GAAGA	4 cut(s)	68, 182, 613, 616
MfeI	CAATTG	1 cut(s)	519
MflI	RGATCY	1 cut(s)	425
MlyI	GAGTC	2 cut(s)	267, 446
MmeI	TCCRAC	1 cut(s)	416
MnlI	CCTC	4 cut(s)	82, 306, 373, 477
Mph1103I	ATGCAT	1 cut(s)	355
MseI	TTAA	1 cut(s)	279
MunI	CAATTG	1 cut(s)	519
MwoI	GCNNNNNNNGC	2 cut(s)	129, 521
NdeII	GATC	2 cut(s)	325, 425
NlaIII	CATG	2 cut(s)	70, 403
NlaIV	GGNNCC	3 cut(s)	384, 385, 460
NsiI	ATGCAT	1 cut(s)	355
NspI	RCATGY	1 cut(s)	70
PciI	ACATGT	1 cut(s)	66
PkrI	GCNGC	1 cut(s)	517
PleI	GAGTC	2 cut(s)	266, 445
PpsI	GAGTC	2 cut(s)	266, 445
PpuMI	RGGWCCY	1 cut(s)	383
PscI	ACATGT	1 cut(s)	66
Psp5II	RGGWCCY	1 cut(s)	383
PspN4I	GGNNCC	3 cut(s)	384, 385, 460
PspPI	GGNCC	2 cut(s)	383, 459
PspPPI	RGGWCCY	1 cut(s)	383
PsuI	RGATCY	1 cut(s)	425
SaqAI	TTAA	1 cut(s)	279
SatI	GCNGC	1 cut(s)	516
Sau3AI	GATC	2 cut(s)	325, 425
Sau96I	GGNCC	2 cut(s)	383, 459
SchI	GAGTC	2 cut(s)	267, 446
SetI	ASST	5 cut(s)	142, 314, 436, 447, 663
SfaNI	GCATC	5 cut(s)	103, 358, 362, 618, 645
SinI	GGWCC	2 cut(s)	383, 459
SsiI	CCGC	1 cut(s)	387
SspMI	CTAG	2 cut(s)	365, 685
StyI	CCWWGG	1 cut(s)	496
TaaI	ACNGT	1 cut(s)	184
TaqI	TCGA	1 cut(s)	509
Tru1I	TTAA	1 cut(s)	279
Tru9I	TTAA	1 cut(s)	279
TscAI	CASTG	1 cut(s)	532
TseI	GCWGC	1 cut(s)	515
TspDTI	ATGAA	3 cut(s)	183, 321, 533
TspRI	CASTG	1 cut(s)	532
VpaK11BI	GGWCC	2 cut(s)	383, 459
XapI	RAATTY	6 cut(s)	290, 373, 531, 540, 642, 648
XceI	RCATGY	1 cut(s)	70
XspI	CTAG	2 cut(s)	365, 685
Zsp2I	ATGCAT	1 cut(s)	355

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.