MD14G1045400.v1.1

Carboxylesterase

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr14
Physical Location & Seq
Reverse (-)
4305999 .. 4307245
1247 bp
Loading structure...
UTR
Exon/CDS
Intron
MD14G1045400.v1.1.491

Sequence Viewer

Length: 186 bp
ATGTTAACTGCCTTCTATAATTTGGTGGAGAGTTACTGGAGAAAGTTAAAAGATTTGGGAAAGAAAATTGAGTATGTCGAATTTGAAGGACAGGAACATGGGTTTTTAACGAATGATCCATACTCAGAAGTCTCAAATGAAGCTTTGCAAGTTATTAAAAGATTTATGACTGAAAACTGCAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

7.27

Weight (kDa)

4.97

Isoelectric Point (pI)

29.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 110
AcsI RAATTY 1 cut(s) 80
AgsI TTSAA 1 cut(s) 86
AluBI AGCT 1 cut(s) 143
AluI AGCT 1 cut(s) 143
Alw26I GTCTC 1 cut(s) 136
AlwI GGATC 1 cut(s) 110
ApoI RAATTY 1 cut(s) 80
BcoDI GTCTC 1 cut(s) 136
BpmI CTGGAG 1 cut(s) 58
Bse1I ACTGG 1 cut(s) 41
BseMII CTCAG 1 cut(s) 138
BseNI ACTGG 1 cut(s) 41
BsmAI GTCTC 1 cut(s) 136
Bsp143I GATC 1 cut(s) 115
BspCNI CTCAG 1 cut(s) 137
BspPI GGATC 1 cut(s) 110
BsrI ACTGG 1 cut(s) 41
BssMI GATC 1 cut(s) 115
BstDEI CTNAG 1 cut(s) 124
BstKTI GATC 1 cut(s) 118
BstMAI GTCTC 1 cut(s) 136
BstMBI GATC 1 cut(s) 115
CviAII CATG 1 cut(s) 98
CviJI RGCY 1 cut(s) 143
CviKI_1 RGCY 1 cut(s) 143
DdeI CTNAG 1 cut(s) 124
DpnI GATC 1 cut(s) 117
DpnII GATC 1 cut(s) 115
FaeI CATG 1 cut(s) 101
FaiI YATR 5 cut(s) 18, 75, 99, 121, 167
FatI CATG 1 cut(s) 97
GsuI CTGGAG 1 cut(s) 58
Hin1II CATG 1 cut(s) 101
HincII GTYRAC 1 cut(s) 6
HindII GTYRAC 1 cut(s) 6
HindIII AAGCTT 1 cut(s) 141
HpaI GTTAAC 1 cut(s) 6
Hpy166II GTNNAC 1 cut(s) 6
Hpy188I TCNGA 1 cut(s) 127
Hpy8I GTNNAC 1 cut(s) 6
HpyAV CCTTC 2 cut(s) 22, 80
HpyCH4V TGCA 2 cut(s) 148, 180
HpyF3I CTNAG 1 cut(s) 124
Hsp92II CATG 1 cut(s) 101
KspAI GTTAAC 1 cut(s) 6
Kzo9I GATC 1 cut(s) 115
LpnPI CCDG 2 cut(s) 22, 77
MaeIII GTNAC 1 cut(s) 32
MalI GATC 1 cut(s) 117
MboI GATC 1 cut(s) 115
MluCI AATT 3 cut(s) 19, 66, 80
MseI TTAA 4 cut(s) 5, 47, 107, 156
NdeII GATC 1 cut(s) 115
NlaIII CATG 1 cut(s) 101
SaqAI TTAA 4 cut(s) 5, 47, 107, 156
Sau3AI GATC 1 cut(s) 115
SetI ASST 1 cut(s) 145
SgeI CNNG 4 cut(s) 49, 104, 110, 161
Sse9I AATT 3 cut(s) 19, 66, 80
TaqI TCGA 1 cut(s) 78
TasI AATT 3 cut(s) 19, 66, 80
Tru1I TTAA 4 cut(s) 5, 47, 107, 156
Tru9I TTAA 4 cut(s) 5, 47, 107, 156
TspDTI ATGAA 1 cut(s) 153
XapI RAATTY 1 cut(s) 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.