Prupe.1G517900_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
42561535 .. 42562931
1397 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G517900.1

Sequence Viewer

Length: 306 bp
ATGTCGCCGATGCTAATGCGGAGGAGGAAAGTGGCTAGGGTTGGAGTGAGAGGGGGTGGGGGTGGTGAAGGCACTGGGTCATACCAGACCTACTCTCTATTTCTCTATTTCTCTTCCTCCCTCTCCCCCTATCTTCGTCATTCCCATCCTCCTCCCTTTATTTCTCTCCTTTTGTGGCTCAGTTTGATTGGATTGGACAAATTAGGTTTTTTAGGTTCGGGTCATTATGGATTTGGAGCAACAACTTATAGGGCTAGTGAGTTATTTGGTTCTGATTGTGAGGTTGATCTTGTTTTGGATGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

102

Amino Acids

11.02

Weight (kDa)

8.89

Isoelectric Point (pI)

49.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 19
AsuHPI GGTGA 1 cut(s) 77
BccI CCATC 1 cut(s) 153
BcgI CGANNNNNNTGC 1 cut(s) 32
BfaI CTAG 2 cut(s) 36, 255
BmrI ACTGGG 1 cut(s) 84
BmuI ACTGGG 1 cut(s) 84
Bse1I ACTGG 1 cut(s) 79
BseGI GGATG 2 cut(s) 145, 304
BseMII CTCAG 1 cut(s) 193
BseNI ACTGG 1 cut(s) 79
BseRI GAGGAG 2 cut(s) 37, 141
Bsp143I GATC 1 cut(s) 286
BspACI CCGC 1 cut(s) 19
BspCNI CTCAG 1 cut(s) 192
BsrI ACTGG 1 cut(s) 79
BssMI GATC 1 cut(s) 286
Bst6I CTCTTC 1 cut(s) 118
BstDEI CTNAG 1 cut(s) 179
BstF5I GGATG 2 cut(s) 145, 304
BstKTI GATC 1 cut(s) 289
BstMBI GATC 1 cut(s) 286
BtsCI GGATG 2 cut(s) 145, 304
BtsIMutI CAGTG 1 cut(s) 72
CviJI RGCY 3 cut(s) 35, 178, 254
CviKI_1 RGCY 3 cut(s) 35, 178, 254
DdeI CTNAG 1 cut(s) 179
DpnI GATC 1 cut(s) 288
DpnII GATC 1 cut(s) 286
Eam1104I CTCTTC 1 cut(s) 118
EarI CTCTTC 1 cut(s) 118
FaiI YATR 3 cut(s) 82, 228, 249
FokI GGATG 1 cut(s) 132
FspBI CTAG 2 cut(s) 36, 255
HphI GGTGA 1 cut(s) 77
Hpy188I TCNGA 1 cut(s) 274
HpyAV CCTTC 1 cut(s) 62
HpyF3I CTNAG 1 cut(s) 179
Kzo9I GATC 1 cut(s) 286
LmnI GCTCC 1 cut(s) 236
LpnPI CCDG 2 cut(s) 60, 98
MaeI CTAG 2 cut(s) 36, 255
MalI GATC 1 cut(s) 288
MboI GATC 1 cut(s) 286
MboII GAAGA 2 cut(s) 105, 125
MluCI AATT 1 cut(s) 200
MmeI TCCRAC 1 cut(s) 22
MnlI CCTC 8 cut(s) 15, 18, 44, 127, 131, 159, 162, 274
NdeII GATC 1 cut(s) 286
Sau3AI GATC 1 cut(s) 286
SetI ASST 4 cut(s) 92, 208, 217, 285
SgeI CNNG 6 cut(s) 48, 87, 97, 231, 267, 302
Sse9I AATT 1 cut(s) 200
SsiI CCGC 1 cut(s) 19
SspMI CTAG 2 cut(s) 36, 255
TasI AATT 1 cut(s) 200
TscAI CASTG 1 cut(s) 79
TspRI CASTG 1 cut(s) 79
XspI CTAG 2 cut(s) 36, 255
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.