Rmu_sc0011921.1_g000014

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011921.1
Physical Location & Seq
Reverse (-)
64939 .. 65187
249 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011921.1_g000014.1.cds

Sequence Viewer

Length: 249 bp
atggacgccactgtccccccagccccaatccccgaccagaacctgttgtccggcccatacgtgcaggcattccgtgacccgaaaacctgggccaaagcctacagagagtgcgagtccaatatcctacaccaatgcgaggtcgggtcgagaatcgggtgcgccatcatcacatcgagcaagtgtaagctgtcgtggtggcagtttctgattgggcaaaaagcaccggacttgaagcagaggacagagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.23

Weight (kDa)

8.42

Isoelectric Point (pI)

34.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 11
AcyI GRCGYC 1 cut(s) 6
AfiI CCNNNNNNNGG 1 cut(s) 136
AgsI TTSAA 1 cut(s) 232
AjnI CCWGG 1 cut(s) 86
AloI GAACNNNNNNTCC 2 cut(s) 32, 64
AluBI AGCT 1 cut(s) 187
AluI AGCT 1 cut(s) 187
AlwNI CAGNNNCTG 2 cut(s) 43, 205
AoxI GGCC 2 cut(s) 52, 90
AspLEI GCGC 1 cut(s) 161
AspS9I GGNCC 2 cut(s) 53, 90
BccI CCATC 1 cut(s) 170
BciT130I CCWGG 1 cut(s) 88
BfmI CTRYAG 1 cut(s) 100
Bme1390I CCNGG 1 cut(s) 88
BmgT120I GGNCC 2 cut(s) 53, 90
BmrFI CCNGG 1 cut(s) 88
BsaAI YACGTR 1 cut(s) 61
BsaHI GRCGYC 1 cut(s) 6
BsaJI CCNNGG 1 cut(s) 87
BsaWI WCCGGW 1 cut(s) 223
Bsc4I CCNNNNNNNGG 1 cut(s) 136
BseBI CCWGG 1 cut(s) 88
BseDI CCNNGG 1 cut(s) 87
BseLI CCNNNNNNNGG 1 cut(s) 136
BseYI CCCAGC 1 cut(s) 19
BsgI GTGCAG 1 cut(s) 83
BshFI GGCC 2 cut(s) 54, 92
BsiSI CCGG 2 cut(s) 51, 224
BslI CCNNNNNNNGG 1 cut(s) 136
BsmI GAATGC 1 cut(s) 68
BsnI GGCC 2 cut(s) 54, 92
BspANI GGCC 2 cut(s) 54, 92
BssECI CCNNGG 1 cut(s) 87
BssNI GRCGYC 1 cut(s) 6
Bst2UI CCWGG 1 cut(s) 88
Bst4CI ACNGT 1 cut(s) 13
BstACI GRCGYC 1 cut(s) 6
BstBAI YACGTR 1 cut(s) 61
BstC8I GCNNGC 1 cut(s) 66
BstHHI GCGC 1 cut(s) 161
BstNI CCWGG 1 cut(s) 88
BstSCI CCNGG 1 cut(s) 86
BstSFI CTRYAG 1 cut(s) 100
BsuRI GGCC 2 cut(s) 54, 92
BtsIMutI CAGTG 1 cut(s) 9
Cac8I GCNNGC 1 cut(s) 66
CaiI CAGNNNCTG 2 cut(s) 43, 205
CfoI GCGC 1 cut(s) 161
Cfr13I GGNCC 2 cut(s) 53, 90
CseI GACGC 1 cut(s) 14
CviJI RGCY 5 cut(s) 23, 54, 92, 98, 187
CviKI_1 RGCY 5 cut(s) 23, 54, 92, 98, 187
DrdI GACNNNNNNGTC 1 cut(s) 11
DseDI GACNNNNNNGTC 1 cut(s) 11
EcoRII CCWGG 1 cut(s) 86
FaiI YATR 1 cut(s) 58
GlaI GCGC 1 cut(s) 160
GsaI CCCAGC 1 cut(s) 23
HaeIII GGCC 2 cut(s) 54, 92
HapII CCGG 2 cut(s) 51, 224
HgaI GACGC 1 cut(s) 14
HhaI GCGC 1 cut(s) 161
Hin1I GRCGYC 1 cut(s) 6
Hin6I GCGC 1 cut(s) 159
HinP1I GCGC 1 cut(s) 159
HinfI GANTC 2 cut(s) 113, 150
HpaII CCGG 2 cut(s) 51, 224
Hpy188I TCNGA 1 cut(s) 207
Hpy188III TCNNGA 1 cut(s) 147
HpyCH4III ACNGT 1 cut(s) 13
HpyCH4IV ACGT 1 cut(s) 60
HpyCH4V TGCA 1 cut(s) 64
HpySE526I ACGT 1 cut(s) 60
Hsp92I GRCGYC 1 cut(s) 6
HspAI GCGC 1 cut(s) 159
LpnPI CCDG 8 cut(s) 33, 50, 50, 56, 64, 73, 100, 237
MaeII ACGT 1 cut(s) 60
MaeIII GTNAC 1 cut(s) 74
MlyI GAGTC 1 cut(s) 122
MnlI CCTC 2 cut(s) 130, 231
MspI CCGG 2 cut(s) 51, 224
MspR9I CCNGG 1 cut(s) 88
Mva1269I GAATGC 1 cut(s) 68
MvaI CCWGG 1 cut(s) 88
NmuCI GTSAC 1 cut(s) 74
PctI GAATGC 1 cut(s) 68
PfeI GAWTC 1 cut(s) 150
PleI GAGTC 1 cut(s) 121
PpsI GAGTC 1 cut(s) 121
Ppu21I YACGTR 1 cut(s) 61
Psp6I CCWGG 1 cut(s) 86
PspFI CCCAGC 1 cut(s) 19
PspGI CCWGG 1 cut(s) 86
PspPI GGNCC 2 cut(s) 53, 90
PstNI CAGNNNCTG 2 cut(s) 43, 205
Sau96I GGNCC 2 cut(s) 53, 90
SchI GAGTC 1 cut(s) 122
ScrFI CCNGG 1 cut(s) 88
SetI ASST 5 cut(s) 45, 63, 89, 141, 189
SfcI CTRYAG 1 cut(s) 100
StyD4I CCNGG 1 cut(s) 86
TaaI ACNGT 1 cut(s) 13
TaiI ACGT 1 cut(s) 63
TaqI TCGA 2 cut(s) 146, 173
TfiI GAWTC 1 cut(s) 150
TscAI CASTG 1 cut(s) 16
TseFI GTSAC 1 cut(s) 74
Tsp45I GTSAC 1 cut(s) 74
TspGWI ACGGA 1 cut(s) 62
TspRI CASTG 1 cut(s) 16
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.