Prupe.4G022700_v2.0.a1

mediator of RNA polymerase II transcription subunit

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Reverse (-)
1073101 .. 1075401
2301 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G022700.6

Sequence Viewer

Length: 414 bp
ATGGACATAATCTCCCAACTACAGGAACAAGTCAACACAATTGCTTCTCTTGCCTTCAATACCTTTGGAACACTACAAAGGGATTCGCCACCAGTTAGACTTTCACCAAATTACCCAGAACCACCTGCGAATCCGACGGAGGATGCAGAGAATTTTGCTGAACATGCCAAGCTCGTGAGTGCCGCTCTGGTTAAGGCTGCTAAGCAGTTTGATGCATTAGTTGCAGCACTTCCTTTAGCTGAGGGAGGGGAAGAAGCACAGCTGAAAAGGATTGCAGAACTGCAGGCTGAAAATGACGCTGTTGGCCAAGAACTTCAGAGGCAACTGGAAGCTGCAGAGAAAGAATTAAAGGAGGTCCGTGAATTGTTCAGCCAAGCAGCAGATAATTGCTTGAACTTGAAGAAACCCGATTAA

Protein Analysis

138

Amino Acids

14.95

Weight (kDa)

4.57

Isoelectric Point (pI)

49.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 133
Acc36I ACCTGC 1 cut(s) 133
AccBSI CCGCTC 1 cut(s) 185
AciI CCGC 1 cut(s) 183
AcoI YGGCCR 1 cut(s) 304
AcsI RAATTY 1 cut(s) 151
AcuI CTGAAG 1 cut(s) 299
AfiI CCNNNNNNNGG 1 cut(s) 22
AgsI TTSAA 3 cut(s) 58, 394, 400
AluBI AGCT 4 cut(s) 172, 239, 262, 332
AluI AGCT 4 cut(s) 172, 239, 262, 332
AoxI GGCC 1 cut(s) 304
ApeKI GCWGC 4 cut(s) 197, 224, 332, 377
ApoI RAATTY 1 cut(s) 151
AspS9I GGNCC 1 cut(s) 355
AsuHPI GGTGA 1 cut(s) 96
AvaII GGWCC 1 cut(s) 355
BalI TGGCCA 1 cut(s) 306
BauI CACGAG 1 cut(s) 173
BbvCI CCTCAGC 1 cut(s) 240
BbvI GCAGC 4 cut(s) 184, 236, 319, 389
BfmI CTRYAG 3 cut(s) 20, 281, 333
BfuAI ACCTGC 1 cut(s) 133
BisI GCNGC 5 cut(s) 183, 198, 225, 333, 378
BlpI GCTNAGC 1 cut(s) 201
BlsI GCNGC 5 cut(s) 184, 199, 226, 334, 379
Bme18I GGWCC 1 cut(s) 355
BmgT120I GGNCC 1 cut(s) 355
BmsI GCATC 2 cut(s) 133, 202
BplI GAGNNNNNCTC 2 cut(s) 169, 201
Bpu10I CCTNAGC 1 cut(s) 240
Bpu1102I GCTNAGC 1 cut(s) 201
BsaXI ACNNNNNCTCC 1 cut(s) 26
Bsc4I CCNNNNNNNGG 1 cut(s) 22
Bse1I ACTGG 2 cut(s) 92, 330
BseGI GGATG 1 cut(s) 148
BseLI CCNNNNNNNGG 1 cut(s) 22
BseMII CTCAG 1 cut(s) 231
BseNI ACTGG 2 cut(s) 92, 330
BseXI GCAGC 4 cut(s) 184, 236, 319, 389
BshFI GGCC 1 cut(s) 306
BslI CCNNNNNNNGG 1 cut(s) 22
BsnI GGCC 1 cut(s) 306
Bsp1720I GCTNAGC 1 cut(s) 201
BspACI CCGC 1 cut(s) 183
BspANI GGCC 1 cut(s) 306
BspCNI CTCAG 1 cut(s) 232
BspMAI CTGCAG 2 cut(s) 285, 337
BspMI ACCTGC 1 cut(s) 133
BsrBI CCGCTC 1 cut(s) 185
BsrI ACTGG 2 cut(s) 92, 330
BssSI CACGAG 1 cut(s) 173
Bst2BI CACGAG 1 cut(s) 173
BstAPI GCANNNNNTGC 1 cut(s) 221
BstC8I GCNNGC 1 cut(s) 285
BstDEI CTNAG 2 cut(s) 201, 240
BstF5I GGATG 1 cut(s) 148
BstMWI GCNNNNNNNGC 3 cut(s) 50, 164, 221
BstNSI RCATGY 1 cut(s) 167
BstSFI CTRYAG 3 cut(s) 20, 281, 333
BstV1I GCAGC 4 cut(s) 184, 236, 319, 389
BsuRI GGCC 1 cut(s) 306
BtsCI GGATG 1 cut(s) 148
BveI ACCTGC 1 cut(s) 133
Cac8I GCNNGC 1 cut(s) 285
Cfr13I GGNCC 1 cut(s) 355
CseI GACGC 1 cut(s) 305
CviAII CATG 1 cut(s) 164
CviJI RGCY 8 cut(s) 172, 197, 239, 262, 287, 306, 332, 372
CviKI_1 RGCY 8 cut(s) 172, 197, 239, 262, 287, 306, 332, 372
DdeI CTNAG 2 cut(s) 201, 240
EaeI YGGCCR 1 cut(s) 304
Eco47I GGWCC 1 cut(s) 355
Eco57I CTGAAG 1 cut(s) 299
EcoT22I ATGCAT 1 cut(s) 217
FaeI CATG 1 cut(s) 167
FaiI YATR 2 cut(s) 8, 165
FatI CATG 1 cut(s) 163
Fnu4HI GCNGC 5 cut(s) 183, 198, 225, 333, 378
FokI GGATG 1 cut(s) 155
Fsp4HI GCNGC 5 cut(s) 183, 198, 225, 333, 378
GluI GCNGC 5 cut(s) 183, 198, 225, 333, 378
HaeIII GGCC 1 cut(s) 306
HgaI GACGC 1 cut(s) 305
Hin1II CATG 1 cut(s) 167
HincII GTYRAC 1 cut(s) 34
HindII GTYRAC 1 cut(s) 34
HinfI GANTC 2 cut(s) 83, 130
HphI GGTGA 1 cut(s) 96
Hpy166II GTNNAC 1 cut(s) 34
Hpy188I TCNGA 2 cut(s) 135, 318
Hpy188III TCNNGA 1 cut(s) 175
Hpy8I GTNNAC 1 cut(s) 34
Hpy99I CGWCG 1 cut(s) 139
HpyAV CCTTC 1 cut(s) 64
HpyCH4V TGCA 6 cut(s) 146, 215, 224, 275, 283, 335
HpyF10VI GCNNNNNNNGC 3 cut(s) 50, 164, 221
HpyF3I CTNAG 2 cut(s) 201, 240
Hsp92II CATG 1 cut(s) 167
LpnPI CCDG 7 cut(s) 8, 105, 129, 138, 173, 269, 311
Lsp1109I GCAGC 4 cut(s) 184, 236, 319, 389
LweI GCATC 2 cut(s) 133, 202
MbiI CCGCTC 1 cut(s) 185
MboII GAAGA 2 cut(s) 263, 412
MfeI CAATTG 1 cut(s) 39
MlsI TGGCCA 1 cut(s) 306
MluCI AATT 6 cut(s) 39, 109, 151, 344, 362, 385
MluNI TGGCCA 1 cut(s) 306
MmeI TCCRAC 1 cut(s) 158
MnlI CCTC 5 cut(s) 133, 235, 239, 312, 346
Mox20I TGGCCA 1 cut(s) 306
Mph1103I ATGCAT 1 cut(s) 217
MscI TGGCCA 1 cut(s) 306
MseI TTAA 3 cut(s) 192, 347, 412
Msp20I TGGCCA 1 cut(s) 306
MspA1I CMGCKG 1 cut(s) 262
MunI CAATTG 1 cut(s) 39
MwoI GCNNNNNNNGC 3 cut(s) 50, 164, 221
NlaIII CATG 1 cut(s) 167
NsiI ATGCAT 1 cut(s) 217
NspI RCATGY 1 cut(s) 167
PaqCI CACCTGC 1 cut(s) 133
PfeI GAWTC 2 cut(s) 83, 130
PkrI GCNGC 5 cut(s) 184, 199, 226, 334, 379
PspPI GGNCC 1 cut(s) 355
PstI CTGCAG 2 cut(s) 285, 337
PvuII CAGCTG 1 cut(s) 262
SaqAI TTAA 3 cut(s) 192, 347, 412
SatI GCNGC 5 cut(s) 183, 198, 225, 333, 378
Sau96I GGNCC 1 cut(s) 355
SetI ASST 7 cut(s) 65, 127, 174, 241, 264, 334, 357
SfaNI GCATC 2 cut(s) 133, 202
SfcI CTRYAG 3 cut(s) 20, 281, 333
SinI GGWCC 1 cut(s) 355
Sse9I AATT 6 cut(s) 39, 109, 151, 344, 362, 385
SsiI CCGC 1 cut(s) 183
TasI AATT 6 cut(s) 39, 109, 151, 344, 362, 385
TauI GCSGC 1 cut(s) 185
TfiI GAWTC 2 cut(s) 83, 130
Tru1I TTAA 3 cut(s) 192, 347, 412
Tru9I TTAA 3 cut(s) 192, 347, 412
TseI GCWGC 4 cut(s) 197, 224, 332, 377
TspGWI ACGGA 2 cut(s) 152, 347
VpaK11BI GGWCC 1 cut(s) 355
XapI RAATTY 1 cut(s) 151
XceI RCATGY 1 cut(s) 167
Zsp2I ATGCAT 1 cut(s) 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.