Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000953.1

Orthogroup ID

OG0001458

Physical Location & Seq

Genomic Coordinates Forward (+)

39764 .. 40969

Gene Structure 1206 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000953.1_g000011.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 630 bp

atgcctcatatggttcgtgaagttgaaattttgttggcaatgcggagtggcagacatgatcgaatgaaggagcagtgtgtaattaagcgccttcgagcctgctcccaaaacgacgtcggcgccccgctcttcttcaaagttgctgctgcccttgttcgagttcgagcttcagcaaagcaagccaagatggacgcaatcagccaattacaagaacaggtgaacaaaatcgcgaccattgctttcaccaccatcggaaccctacagagggacgctccacccgtccgaatctcccccaattaccccgaatccgagtcagcaccgcaacccaacccgaacccgaacccgaatccgactgacgatgccgccgattttgcgatgcagcccaagctaatgagcgcggatctagtcaaagcagccaagcagtttgatgcattggtttcggcacttccgctgtcggagggaggcgaggaagctcagatgaagaggattgcggagcttcaggccgaaaacagccttgtaggccaacaacttgagaagcaacttgaagctgcagagagagaactggaagaggtcagagagttgtttggccaagcagcagatcactgtttgaacttgaagaaaccagaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Med21

Protein Analysis

209

Amino Acids

23.05

Weight (kDa)

5.76

Isoelectric Point (pI)

53.13

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001458)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G04780
fragaria_vesca	FvH4_3g18180 FvH4_3g18181 FvH4_4g21200
malus_domestica	MD10G1319700.v1.1
prunus_persica	Prupe.1G108500_v2.0.a1 Prupe.1G108500_v2.0.a1 Prupe.1G108500_v2.0.a1 Prupe.1G108500_v2.0.a1 Prupe.1G108500_v2.0.a1 Prupe.4G022700_v2.0.a1 Prupe.4G022700_v2.0.a1 Prupe.4G022700_v2.0.a1 Prupe.4G022700_v2.0.a1 Prupe.4G022700_v2.0.a1 Prupe.4G022700_v2.0.a1 Prupe.4G022700_v2.0.a1
pyrus_communis	pycom10g27060 pycom16g12330
rosa_chinensis	RchiOBHm_Chr4g0426811 RchiOBHm_Chr5g0030661 RchiOBHm_Chr5g0030681
rosa_laevigata	RLG00000007276 RLG00000033237 RLG00000033242 RLG00000033244
rosa_multiflora	Rmu_sc0000953.1_g000011 Rmu_sc0004341.1_g000003 Rmu_sc0004963.1_g000002
rosa_roxburghii	Rroxscaffold_1G00049620 Rroxscaffold_1G00049630 Rroxscaffold_1G00049640 Rroxscaffold_5G00368780
rosa_rugosa	Rorug04G0215000 Rorug05G0120100 Rorug05G0120100
rosa_samantha	Rh4AG270000 Rh4BG276300 Rh4CG291000 Rh4DG273500 Rh5AG211500 Rh5AG211700 Rh5BG210400 Rh5BG210600 Rh5CG234200 Rh5DG215500 Rh5DG215600 Rh5DG215800 Rh5DG215900
rosa_wichuraiana	Rw4G023430 Rw5G019370 Rw5G019410

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	117
AccB1I	GGYRCC	1 cut(s)	119
AccBSI	CCGCTC	1 cut(s)	127
AccII	CGCG	2 cut(s)	230, 398
AciI	CCGC	7 cut(s)	43, 125, 320, 363, 398, 449, 491
AclWI	GGATC	1 cut(s)	408
AcoI	YGGCCR	1 cut(s)	586
AcsI	RAATTY	1 cut(s)	27
AcuI	CTGAAG	2 cut(s)	153, 482
AcyI	GRCGYC	2 cut(s)	114, 120
AfiI	CCNNNNNNNGG	2 cut(s)	264, 265
AgsI	TTSAA	5 cut(s)	26, 136, 545, 610, 616
AluBI	AGCT	5 cut(s)	167, 388, 473, 496, 548
AluI	AGCT	5 cut(s)	167, 388, 473, 496, 548
AlwI	GGATC	1 cut(s)	408
AoxI	GGCC	3 cut(s)	501, 520, 586
ApeKI	GCWGC	6 cut(s)	143, 146, 379, 413, 548, 593
ApoI	RAATTY	1 cut(s)	27
AspLEI	GCGC	3 cut(s)	90, 122, 398
AsuHPI	GGTGA	2 cut(s)	229, 235
BalI	TGGCCA	1 cut(s)	588
BanI	GGYRCC	1 cut(s)	119
BbvI	GCAGC	6 cut(s)	130, 133, 391, 425, 535, 605
BccI	CCATC	2 cut(s)	181, 257
BcgI	CGANNNNNNTGC	2 cut(s)	420, 454
BfaI	CTAG	1 cut(s)	404
BfmI	CTRYAG	2 cut(s)	260, 549
BfoI	RGCGCY	2 cut(s)	91, 123
BglI	GCCNNNNNGGC	1 cut(s)	519
BisI	GCNGC	7 cut(s)	144, 147, 363, 380, 414, 549, 594
BlsI	GCNGC	7 cut(s)	145, 148, 364, 381, 415, 550, 595
BmiI	GGNNCC	2 cut(s)	121, 256
BmsI	GCATC	3 cut(s)	349, 366, 418
BplI	GAGNNNNNCTC	2 cut(s)	256, 288
BpuEI	CTTGAG	1 cut(s)	551
BsaHI	GRCGYC	2 cut(s)	114, 120
Bsc4I	CCNNNNNNNGG	2 cut(s)	264, 265
Bse1I	ACTGG	1 cut(s)	567
Bse3DI	GCAATG	2 cut(s)	45, 234
BseLI	CCNNNNNNNGG	2 cut(s)	264, 265
BseMI	GCAATG	2 cut(s)	45, 234
BseMII	CTCAG	1 cut(s)	488
BseNI	ACTGG	1 cut(s)	567
BseXI	GCAGC	6 cut(s)	130, 133, 391, 425, 535, 605
Bsh1236I	CGCG	2 cut(s)	230, 398
BshFI	GGCC	3 cut(s)	503, 522, 588
BshNI	GGYRCC	1 cut(s)	119
BslFI	GGGAC	1 cut(s)	281
BslI	CCNNNNNNNGG	2 cut(s)	264, 265
BsmFI	GGGAC	1 cut(s)	281
BsnI	GGCC	3 cut(s)	503, 522, 588
Bsp143I	GATC	3 cut(s)	58, 400, 598
Bsp68I	TCGCGA	1 cut(s)	230
BspACI	CCGC	7 cut(s)	43, 125, 320, 363, 398, 449, 491
BspANI	GGCC	3 cut(s)	503, 522, 588
BspCNI	CTCAG	1 cut(s)	487
BspFNI	CGCG	2 cut(s)	230, 398
BspLI	GGNNCC	2 cut(s)	121, 256
BspMAI	CTGCAG	1 cut(s)	553
BspPI	GGATC	1 cut(s)	408
BspQI	GCTCTTC	1 cut(s)	134
BspT107I	GGYRCC	1 cut(s)	119
BsrBI	CCGCTC	1 cut(s)	127
BsrDI	GCAATG	2 cut(s)	45, 234
BsrI	ACTGG	1 cut(s)	567
BssMI	GATC	3 cut(s)	58, 400, 598
BssNI	GRCGYC	2 cut(s)	114, 120
Bst4CI	ACNGT	1 cut(s)	605
Bst6I	CTCTTC	3 cut(s)	134, 476, 561
BstACI	GRCGYC	2 cut(s)	114, 120
BstC8I	GCNNGC	2 cut(s)	100, 180
BstDEI	CTNAG	1 cut(s)	474
BstFNI	CGCG	2 cut(s)	230, 398
BstH2I	RGCGCY	2 cut(s)	91, 123
BstHHI	GCGC	3 cut(s)	90, 122, 398
BstKTI	GATC	3 cut(s)	61, 403, 601
BstMBI	GATC	3 cut(s)	58, 400, 598
BstMWI	GCNNNNNNNGC	5 cut(s)	179, 236, 371, 385, 519
BstSFI	CTRYAG	2 cut(s)	260, 549
BstUI	CGCG	2 cut(s)	230, 398
BstV1I	GCAGC	6 cut(s)	130, 133, 391, 425, 535, 605
BstX2I	RGATCY	1 cut(s)	400
BstYI	RGATCY	1 cut(s)	400
BsuRI	GGCC	3 cut(s)	503, 522, 588
BtgZI	GCGATG	1 cut(s)	389
BtsI	GCAGTG	1 cut(s)	80
BtsIMutI	CAGTG	2 cut(s)	80, 601
BtuMI	TCGCGA	1 cut(s)	230
Cac8I	GCNNGC	2 cut(s)	100, 180
CfoI	GCGC	3 cut(s)	90, 122, 398
CseI	GACGC	2 cut(s)	200, 278
CviAII	CATG	1 cut(s)	56
DdeI	CTNAG	1 cut(s)	474
DinI	GGCGCC	1 cut(s)	121
DpnI	GATC	3 cut(s)	60, 402, 600
DpnII	GATC	3 cut(s)	58, 400, 598
EaeI	YGGCCR	1 cut(s)	586
Eam1104I	CTCTTC	3 cut(s)	134, 476, 561
EarI	CTCTTC	3 cut(s)	134, 476, 561
Eco57I	CTGAAG	2 cut(s)	153, 482
EcoT22I	ATGCAT	1 cut(s)	433
EgeI	GGCGCC	1 cut(s)	121
EheI	GGCGCC	1 cut(s)	121
FaeI	CATG	1 cut(s)	59
FaiI	YATR	3 cut(s)	9, 11, 57
FaqI	GGGAC	1 cut(s)	281
FatI	CATG	1 cut(s)	55
FauI	CCCGC	1 cut(s)	132
FauNDI	CATATG	1 cut(s)	9
Fnu4HI	GCNGC	7 cut(s)	144, 147, 363, 380, 414, 549, 594
Fsp4HI	GCNGC	7 cut(s)	144, 147, 363, 380, 414, 549, 594
FspBI	CTAG	1 cut(s)	404
GlaI	GCGC	3 cut(s)	89, 121, 397
GluI	GCNGC	7 cut(s)	144, 147, 363, 380, 414, 549, 594
HaeII	RGCGCY	2 cut(s)	91, 123
HaeIII	GGCC	3 cut(s)	503, 522, 588
HgaI	GACGC	2 cut(s)	200, 278
HhaI	GCGC	3 cut(s)	90, 122, 398
Hin1I	GRCGYC	2 cut(s)	114, 120
Hin1II	CATG	1 cut(s)	59
Hin6I	GCGC	3 cut(s)	88, 120, 396
HinP1I	GCGC	3 cut(s)	88, 120, 396
HinfI	GANTC	4 cut(s)	285, 305, 311, 346
HphI	GGTGA	2 cut(s)	229, 235
Hpy166II	GTNNAC	1 cut(s)	220
Hpy188I	TCNGA	7 cut(s)	254, 284, 310, 351, 457, 477, 575
Hpy188III	TCNNGA	2 cut(s)	17, 229
Hpy8I	GTNNAC	1 cut(s)	220
Hpy99I	CGWCG	2 cut(s)	116, 119
HpyAV	CCTTC	2 cut(s)	61, 101
HpyCH4III	ACNGT	1 cut(s)	605
HpyCH4IV	ACGT	1 cut(s)	114
HpyCH4V	TGCA	3 cut(s)	379, 431, 551
HpyF10VI	GCNNNNNNNGC	5 cut(s)	179, 236, 371, 385, 519
HpyF3I	CTNAG	1 cut(s)	474
HpySE526I	ACGT	1 cut(s)	114
Hsp92I	GRCGYC	2 cut(s)	114, 120
Hsp92II	CATG	1 cut(s)	59
HspAI	GCGC	3 cut(s)	88, 120, 396
KasI	GGCGCC	1 cut(s)	119
Kzo9I	GATC	3 cut(s)	58, 400, 598
LguI	GCTCTTC	1 cut(s)	134
LmnI	GCTCC	4 cut(s)	70, 107, 277, 493
LpnPI	CCDG	4 cut(s)	112, 200, 485, 548
Lsp1109I	GCAGC	6 cut(s)	130, 133, 391, 425, 535, 605
LweI	GCATC	3 cut(s)	349, 366, 418
MaeI	CTAG	1 cut(s)	404
MaeII	ACGT	1 cut(s)	114
MalI	GATC	3 cut(s)	60, 402, 600
MbiI	CCGCTC	1 cut(s)	127
MboI	GATC	3 cut(s)	58, 400, 598
MboII	GAAGA	5 cut(s)	121, 124, 493, 578, 628
MflI	RGATCY	1 cut(s)	400
MlsI	TGGCCA	1 cut(s)	588
MluCI	AATT	4 cut(s)	27, 81, 203, 295
MluNI	TGGCCA	1 cut(s)	588
Mly113I	GGCGCC	1 cut(s)	120
MlyI	GAGTC	1 cut(s)	320
MmeI	TCCRAC	2 cut(s)	374, 435
MnlI	CCTC	7 cut(s)	15, 258, 451, 455, 460, 477, 562
Mox20I	TGGCCA	1 cut(s)	588
Mph1103I	ATGCAT	1 cut(s)	433
MscI	TGGCCA	1 cut(s)	588
MseI	TTAA	1 cut(s)	84
Msp20I	TGGCCA	1 cut(s)	588
MspA1I	CMGCKG	1 cut(s)	451
MvnI	CGCG	2 cut(s)	230, 398
MwoI	GCNNNNNNNGC	5 cut(s)	179, 236, 371, 385, 519
NarI	GGCGCC	1 cut(s)	120
NdeI	CATATG	1 cut(s)	9
NdeII	GATC	3 cut(s)	58, 400, 598
NlaIII	CATG	1 cut(s)	59
NlaIV	GGNNCC	2 cut(s)	121, 256
NruI	TCGCGA	1 cut(s)	230
NsiI	ATGCAT	1 cut(s)	433
PciSI	GCTCTTC	1 cut(s)	134
PcsI	WCGNNNNNNNCGW	2 cut(s)	276, 363
PfeI	GAWTC	3 cut(s)	285, 305, 346
PkrI	GCNGC	7 cut(s)	145, 148, 364, 381, 415, 550, 595
PleI	GAGTC	1 cut(s)	319
PluTI	GGCGCC	1 cut(s)	123
PpsI	GAGTC	1 cut(s)	319
PspN4I	GGNNCC	2 cut(s)	121, 256
PstI	CTGCAG	1 cut(s)	553
PsuI	RGATCY	1 cut(s)	400
RruI	TCGCGA	1 cut(s)	230
SapI	GCTCTTC	1 cut(s)	134
SaqAI	TTAA	1 cut(s)	84
SatI	GCNGC	7 cut(s)	144, 147, 363, 380, 414, 549, 594
Sau3AI	GATC	3 cut(s)	58, 400, 598
SchI	GAGTC	1 cut(s)	320
SetI	ASST	8 cut(s)	117, 169, 219, 390, 475, 498, 550, 573
SfaNI	GCATC	3 cut(s)	349, 366, 418
SfcI	CTRYAG	2 cut(s)	260, 549
SfoI	GGCGCC	1 cut(s)	121
SmlI	CTYRAG	1 cut(s)	530
SmoI	CTYRAG	1 cut(s)	530
Sse9I	AATT	4 cut(s)	27, 81, 203, 295
SsiI	CCGC	7 cut(s)	43, 125, 320, 363, 398, 449, 491
SspDI	GGCGCC	1 cut(s)	119
SspMI	CTAG	1 cut(s)	404
TaaI	ACNGT	1 cut(s)	605
TaiI	ACGT	1 cut(s)	117
TaqI	TCGA	4 cut(s)	61, 94, 157, 163
TasI	AATT	4 cut(s)	27, 81, 203, 295
TauI	GCSGC	1 cut(s)	365
TfiI	GAWTC	3 cut(s)	285, 305, 346
Tru1I	TTAA	1 cut(s)	84
Tru9I	TTAA	1 cut(s)	84
TscAI	CASTG	2 cut(s)	80, 608
TseI	GCWGC	6 cut(s)	143, 146, 379, 413, 548, 593
TspDTI	ATGAA	2 cut(s)	80, 494
TspRI	CASTG	2 cut(s)	80, 608
XapI	RAATTY	1 cut(s)	27
XspI	CTAG	1 cut(s)	404
ZraI	GACGTC	1 cut(s)	115
Zsp2I	ATGCAT	1 cut(s)	433

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.