pycom01g13680

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Forward (+)
14081869 .. 14085626
3758 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g13680.1

Sequence Viewer

Length: 369 bp
ATGGAAATTGGAGAACACTATCTTGTCGAAAAGGCATGGGAAATGTACAAGGGAAAGAAGCTTGTAGATCTAGTGGACTCTTCTCTCGAACTTGACGGAAACATTTCAGAAAAAGAAGCCGTCCAATTCCTAAAGGTGGGTCTGCTTTGTGTACAAGAAAAATCCAGCCTCCGACCCCGCATGTCGACAGCCATTAAGCTGATGACGACGAATGAGATCAACGTTAATAACATGAAGGTAGGCGAGCCAGGAGTCATTACTGACAATATGGACCTCAAATTAGCCCAAGGGACTGAGAGAAGCTCACCGCCAGCATGCAAAGCCCCCAAATCTATCTTTATTAAAAGAAAAATTAGAAATTTGAATTAA

Protein Analysis

123

Amino Acids

13.69

Weight (kDa)

8.89

Isoelectric Point (pI)

42.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 185
AciI CCGC 2 cut(s) 178, 308
AclI AACGTT 1 cut(s) 222
AcsI RAATTY 1 cut(s) 358
AfaI GTAC 2 cut(s) 47, 153
AfiI CCNNNNNNNGG 1 cut(s) 136
AgsI TTSAA 1 cut(s) 364
AjnI CCWGG 1 cut(s) 247
AluBI AGCT 3 cut(s) 61, 199, 303
AluI AGCT 3 cut(s) 61, 199, 303
ApoI RAATTY 1 cut(s) 358
Asp700I GAANNNNTTC 1 cut(s) 103
AspS9I GGNCC 1 cut(s) 271
AsuHPI GGTGA 1 cut(s) 297
AvaII GGWCC 1 cut(s) 271
BceAI ACGGC 1 cut(s) 104
BciT130I CCWGG 1 cut(s) 249
BfaI CTAG 1 cut(s) 71
BglII AGATCT 1 cut(s) 67
Bme1390I CCNGG 1 cut(s) 249
Bme18I GGWCC 1 cut(s) 271
BmgT120I GGNCC 1 cut(s) 271
BmrFI CCNGG 1 cut(s) 249
BplI GAGNNNNNCTC 2 cut(s) 287, 319
BsaJI CCNNGG 1 cut(s) 286
Bsc4I CCNNNNNNNGG 1 cut(s) 136
BseBI CCWGG 1 cut(s) 249
BseDI CCNNGG 1 cut(s) 286
BseLI CCNNNNNNNGG 1 cut(s) 136
BseMII CTCAG 1 cut(s) 285
BslFI GGGAC 1 cut(s) 304
BslI CCNNNNNNNGG 1 cut(s) 136
BsmFI GGGAC 1 cut(s) 304
Bsp1407I TGTACA 2 cut(s) 45, 151
Bsp143I GATC 2 cut(s) 67, 216
BspACI CCGC 2 cut(s) 178, 308
BspCNI CTCAG 1 cut(s) 286
BsrGI TGTACA 2 cut(s) 45, 151
BssECI CCNNGG 1 cut(s) 286
BssMI GATC 2 cut(s) 67, 216
BssT1I CCWWGG 1 cut(s) 286
Bst2UI CCWGG 1 cut(s) 249
Bst6I CTCTTC 1 cut(s) 85
BstAUI TGTACA 2 cut(s) 45, 151
BstC8I GCNNGC 3 cut(s) 245, 312, 316
BstDEI CTNAG 1 cut(s) 294
BstKTI GATC 2 cut(s) 70, 219
BstMBI GATC 2 cut(s) 67, 216
BstMWI GCNNNNNNNGC 1 cut(s) 320
BstNI CCWGG 1 cut(s) 249
BstNSI RCATGY 2 cut(s) 184, 318
BstSCI CCNGG 1 cut(s) 247
BstX2I RGATCY 1 cut(s) 67
BstYI RGATCY 1 cut(s) 67
Cac8I GCNNGC 3 cut(s) 245, 312, 316
Cfr13I GGNCC 1 cut(s) 271
Csp6I GTAC 2 cut(s) 46, 152
CviAII CATG 4 cut(s) 36, 181, 232, 315
CviJI RGCY 9 cut(s) 61, 119, 168, 191, 199, 247, 284, 303, 323
CviKI_1 RGCY 9 cut(s) 61, 119, 168, 191, 199, 247, 284, 303, 323
CviQI GTAC 2 cut(s) 46, 152
DdeI CTNAG 1 cut(s) 294
DpnI GATC 2 cut(s) 69, 218
DpnII GATC 2 cut(s) 67, 216
Eam1104I CTCTTC 1 cut(s) 85
EarI CTCTTC 1 cut(s) 85
Eco130I CCWWGG 1 cut(s) 286
Eco47I GGWCC 1 cut(s) 271
EcoRII CCWGG 1 cut(s) 247
EcoT14I CCWWGG 1 cut(s) 286
ErhI CCWWGG 1 cut(s) 286
FaeI CATG 4 cut(s) 39, 184, 235, 318
FaiI YATR 5 cut(s) 37, 182, 233, 269, 316
FaqI GGGAC 1 cut(s) 304
FatI CATG 4 cut(s) 35, 180, 231, 314
FauI CCCGC 1 cut(s) 185
FblI GTMKAC 1 cut(s) 185
FspBI CTAG 1 cut(s) 71
Hin1II CATG 4 cut(s) 39, 184, 235, 318
HincII GTYRAC 1 cut(s) 186
HindII GTYRAC 1 cut(s) 186
HindIII AAGCTT 1 cut(s) 59
HinfI GANTC 2 cut(s) 77, 252
HphI GGTGA 1 cut(s) 297
Hpy166II GTNNAC 3 cut(s) 76, 152, 186
Hpy188I TCNGA 2 cut(s) 109, 173
Hpy188III TCNNGA 1 cut(s) 86
Hpy8I GTNNAC 3 cut(s) 76, 152, 186
Hpy99I CGWCG 1 cut(s) 211
HpyAV CCTTC 1 cut(s) 229
HpyCH4IV ACGT 1 cut(s) 222
HpyCH4V TGCA 1 cut(s) 318
HpyF10VI GCNNNNNNNGC 1 cut(s) 320
HpyF3I CTNAG 1 cut(s) 294
HpySE526I ACGT 1 cut(s) 222
Hsp92II CATG 4 cut(s) 39, 184, 235, 318
Kzo9I GATC 2 cut(s) 67, 216
LpnPI CCDG 4 cut(s) 178, 234, 261, 324
MaeI CTAG 1 cut(s) 71
MaeII ACGT 1 cut(s) 222
MalI GATC 2 cut(s) 69, 218
MboI GATC 2 cut(s) 67, 216
MboII GAAGA 1 cut(s) 72
MflI RGATCY 1 cut(s) 67
MluCI AATT 6 cut(s) 6, 125, 278, 351, 358, 364
MlyI GAGTC 2 cut(s) 71, 261
MmeI TCCRAC 1 cut(s) 196
MnlI CCTC 2 cut(s) 179, 284
MroXI GAANNNNTTC 1 cut(s) 103
MseI TTAA 4 cut(s) 195, 225, 342, 367
MspR9I CCNGG 1 cut(s) 249
MvaI CCWGG 1 cut(s) 249
MwoI GCNNNNNNNGC 1 cut(s) 320
NdeII GATC 2 cut(s) 67, 216
NlaIII CATG 4 cut(s) 39, 184, 235, 318
NspI RCATGY 2 cut(s) 184, 318
PaeI GCATGC 1 cut(s) 318
PdmI GAANNNNTTC 1 cut(s) 103
PleI GAGTC 2 cut(s) 71, 260
PpsI GAGTC 2 cut(s) 71, 260
Psp1406I AACGTT 1 cut(s) 222
Psp6I CCWGG 1 cut(s) 247
PspGI CCWGG 1 cut(s) 247
PspPI GGNCC 1 cut(s) 271
PsuI RGATCY 1 cut(s) 67
RsaI GTAC 2 cut(s) 47, 153
RsaNI GTAC 2 cut(s) 46, 152
SalI GTCGAC 1 cut(s) 184
SaqAI TTAA 4 cut(s) 195, 225, 342, 367
Sau3AI GATC 2 cut(s) 67, 216
Sau96I GGNCC 1 cut(s) 271
SchI GAGTC 2 cut(s) 71, 261
ScrFI CCNGG 1 cut(s) 249
SetI ASST 7 cut(s) 63, 138, 201, 225, 240, 276, 305
SinI GGWCC 1 cut(s) 271
SphI GCATGC 1 cut(s) 318
Sse9I AATT 6 cut(s) 6, 125, 278, 351, 358, 364
SsiI CCGC 2 cut(s) 178, 308
SspMI CTAG 1 cut(s) 71
StyD4I CCNGG 1 cut(s) 247
StyI CCWWGG 1 cut(s) 286
TaiI ACGT 1 cut(s) 225
TaqI TCGA 3 cut(s) 27, 87, 185
TasI AATT 6 cut(s) 6, 125, 278, 351, 358, 364
TatI WGTACW 2 cut(s) 45, 151
Tru1I TTAA 4 cut(s) 195, 225, 342, 367
Tru9I TTAA 4 cut(s) 195, 225, 342, 367
TspDTI ATGAA 1 cut(s) 248
TspGWI ACGGA 1 cut(s) 111
VpaK11BI GGWCC 1 cut(s) 271
XapI RAATTY 1 cut(s) 358
XceI RCATGY 2 cut(s) 184, 318
XmiI GTMKAC 1 cut(s) 185
XmnI GAANNNNTTC 1 cut(s) 103
XspI CTAG 1 cut(s) 71
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.