pycom01g14620

60S ribosomal protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Reverse (-)
14729550 .. 14730035
486 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g14620.2

Sequence Viewer

Length: 192 bp
ATGTCACAGAAGCAGAAGGCTGCTCTCAGAGAAGTGTACAAGAACAAGAAGCTCTTGCCTCTTGATCTCCGTCCCAAGAAGACCAGGGCCATCCGTCGGAGGCTCACCAAGCACCAGGCATCTTTGAAGACCGAGAGGGAGAAGAAGAAGGAAATGTACTATCCTTTGAGGAAGTATGCCATTAAGGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

7.67

Weight (kDa)

10.8

Isoelectric Point (pI)

70.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 38, 158
AfiI CCNNNNNNNGG 1 cut(s) 96
AgsI TTSAA 1 cut(s) 127
AjnI CCWGG 2 cut(s) 83, 114
AluBI AGCT 1 cut(s) 52
AluI AGCT 1 cut(s) 52
AoxI GGCC 1 cut(s) 87
ApeKI GCWGC 1 cut(s) 20
AspS9I GGNCC 1 cut(s) 87
AsuHPI GGTGA 1 cut(s) 97
BarI GAAGNNNNNNTAC 2 cut(s) 140, 172
BbsI GAAGAC 2 cut(s) 86, 134
BbvI GCAGC 1 cut(s) 7
BccI CCATC 1 cut(s) 98
BciT130I CCWGG 2 cut(s) 85, 116
BglI GCCNNNNNGGC 1 cut(s) 185
BisI GCNGC 1 cut(s) 21
BlsI GCNGC 1 cut(s) 22
Bme1390I CCNGG 2 cut(s) 85, 116
BmgT120I GGNCC 1 cut(s) 87
BmrFI CCNGG 2 cut(s) 85, 116
BmsI GCATC 1 cut(s) 128
BpiI GAAGAC 2 cut(s) 86, 134
BsaJI CCNNGG 1 cut(s) 84
Bsc4I CCNNNNNNNGG 1 cut(s) 96
BseBI CCWGG 2 cut(s) 85, 116
BseDI CCNNGG 1 cut(s) 84
BseGI GGATG 1 cut(s) 90
BseLI CCNNNNNNNGG 1 cut(s) 96
BseMII CTCAG 1 cut(s) 40
BseXI GCAGC 1 cut(s) 7
BshFI GGCC 1 cut(s) 89
BslFI GGGAC 1 cut(s) 57
BslI CCNNNNNNNGG 1 cut(s) 96
BsmFI GGGAC 1 cut(s) 57
BsnI GGCC 1 cut(s) 89
Bsp1407I TGTACA 1 cut(s) 36
Bsp143I GATC 1 cut(s) 64
BspANI GGCC 1 cut(s) 89
BspCNI CTCAG 1 cut(s) 39
BsrGI TGTACA 1 cut(s) 36
BssECI CCNNGG 1 cut(s) 84
BssMI GATC 1 cut(s) 64
Bst2UI CCWGG 2 cut(s) 85, 116
BstAUI TGTACA 1 cut(s) 36
BstDEI CTNAG 2 cut(s) 26, 189
BstF5I GGATG 1 cut(s) 90
BstKTI GATC 1 cut(s) 67
BstMBI GATC 1 cut(s) 64
BstMWI GCNNNNNNNGC 2 cut(s) 109, 185
BstNI CCWGG 2 cut(s) 85, 116
BstSCI CCNGG 2 cut(s) 83, 114
BstV1I GCAGC 1 cut(s) 7
BstV2I GAAGAC 2 cut(s) 86, 134
BsuRI GGCC 1 cut(s) 89
BtsCI GGATG 1 cut(s) 90
Cfr13I GGNCC 1 cut(s) 87
Csp6I GTAC 2 cut(s) 37, 157
CviJI RGCY 5 cut(s) 20, 52, 89, 103, 188
CviKI_1 RGCY 5 cut(s) 20, 52, 89, 103, 188
CviQI GTAC 2 cut(s) 37, 157
DdeI CTNAG 2 cut(s) 26, 189
DpnI GATC 1 cut(s) 66
DpnII GATC 1 cut(s) 64
EcoRII CCWGG 2 cut(s) 83, 114
FaiI YATR 1 cut(s) 177
FalI AAGNNNNNCTT 2 cut(s) 38, 70
FaqI GGGAC 1 cut(s) 57
Fnu4HI GCNGC 1 cut(s) 21
FokI GGATG 1 cut(s) 77
Fsp4HI GCNGC 1 cut(s) 21
GluI GCNGC 1 cut(s) 21
HaeIII GGCC 1 cut(s) 89
HphI GGTGA 1 cut(s) 97
Hpy166II GTNNAC 1 cut(s) 37
Hpy188I TCNGA 2 cut(s) 29, 99
Hpy188III TCNNGA 1 cut(s) 62
Hpy8I GTNNAC 1 cut(s) 37
Hpy99I CGWCG 1 cut(s) 99
HpyAV CCTTC 2 cut(s) 10, 142
HpyF10VI GCNNNNNNNGC 2 cut(s) 109, 185
HpyF3I CTNAG 2 cut(s) 26, 189
Kzo9I GATC 1 cut(s) 64
LpnPI CCDG 4 cut(s) 70, 97, 101, 128
Lsp1109I GCAGC 1 cut(s) 7
LweI GCATC 1 cut(s) 128
MaeIII GTNAC 1 cut(s) 3
MalI GATC 1 cut(s) 66
MboI GATC 1 cut(s) 64
MboII GAAGA 4 cut(s) 91, 139, 154, 157
MmeI TCCRAC 1 cut(s) 77
MnlI CCTC 4 cut(s) 69, 93, 129, 162
MseI TTAA 1 cut(s) 183
MspR9I CCNGG 2 cut(s) 85, 116
MvaI CCWGG 2 cut(s) 85, 116
MwoI GCNNNNNNNGC 2 cut(s) 109, 185
NdeII GATC 1 cut(s) 64
NmuCI GTSAC 1 cut(s) 3
PkrI GCNGC 1 cut(s) 22
Psp6I CCWGG 2 cut(s) 83, 114
PspGI CCWGG 2 cut(s) 83, 114
PspPI GGNCC 1 cut(s) 87
RsaI GTAC 2 cut(s) 38, 158
RsaNI GTAC 2 cut(s) 37, 157
SaqAI TTAA 1 cut(s) 183
SatI GCNGC 1 cut(s) 21
Sau3AI GATC 1 cut(s) 64
Sau96I GGNCC 1 cut(s) 87
ScrFI CCNGG 2 cut(s) 85, 116
SetI ASST 1 cut(s) 54
SfaNI GCATC 1 cut(s) 128
StyD4I CCNGG 2 cut(s) 83, 114
TaqII GACCGA 1 cut(s) 146
TatI WGTACW 2 cut(s) 36, 156
Tru1I TTAA 1 cut(s) 183
Tru9I TTAA 1 cut(s) 183
TseFI GTSAC 1 cut(s) 3
TseI GCWGC 1 cut(s) 20
Tsp45I GTSAC 1 cut(s) 3
TspGWI ACGGA 2 cut(s) 59, 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.