pycom02g25090

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr2
Physical Location & Seq
Forward (+)
23122505 .. 23123827
1323 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom02g25090.1

Sequence Viewer

Length: 216 bp
ATGGTGGAGAGTTCATCACGCAAGAGGGAGAATGCATTTGCTTCCTCTGTTCCTCGCAATAAAGTTCCTAGAGGTAACTTGCCTCATTCCAGGAATGTTCCAGATACAGTTGGTGGTCTGCTGGTTCCGCCTCAGCTTCGTGGAAGGAGCAACATTGTTACAGAAGATGTAGGAAAGCTATTTGTCAAAAAGCAGGCTGACCCTTCACCAAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

7.75

Weight (kDa)

10.96

Isoelectric Point (pI)

72.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 128
AjnI CCWGG 1 cut(s) 89
AluBI AGCT 2 cut(s) 136, 178
AluI AGCT 2 cut(s) 136, 178
AsuHPI GGTGA 1 cut(s) 198
BbvCI CCTCAGC 1 cut(s) 132
BciT130I CCWGG 1 cut(s) 91
BfaI CTAG 1 cut(s) 69
Bme1390I CCNGG 1 cut(s) 91
BmiI GGNNCC 1 cut(s) 126
BmrFI CCNGG 1 cut(s) 91
Bpu10I CCTNAGC 1 cut(s) 132
BseBI CCWGG 1 cut(s) 91
BseMII CTCAG 1 cut(s) 146
BsmI GAATGC 1 cut(s) 37
BspACI CCGC 1 cut(s) 128
BspCNI CTCAG 1 cut(s) 145
BspLI GGNNCC 1 cut(s) 126
Bst2UI CCWGG 1 cut(s) 91
Bst4CI ACNGT 1 cut(s) 109
BstC8I GCNNGC 1 cut(s) 195
BstDEI CTNAG 1 cut(s) 132
BstMWI GCNNNNNNNGC 1 cut(s) 127
BstNI CCWGG 1 cut(s) 91
BstSCI CCNGG 1 cut(s) 89
Cac8I GCNNGC 1 cut(s) 195
CviJI RGCY 3 cut(s) 136, 178, 197
CviKI_1 RGCY 3 cut(s) 136, 178, 197
DdeI CTNAG 1 cut(s) 132
EciI GGCGGA 1 cut(s) 117
EcoRII CCWGG 1 cut(s) 89
EcoT22I ATGCAT 1 cut(s) 37
FspBI CTAG 1 cut(s) 69
HphI GGTGA 1 cut(s) 198
Hpy188III TCNNGA 1 cut(s) 101
HpyAV CCTTC 2 cut(s) 138, 213
HpyCH4III ACNGT 1 cut(s) 109
HpyCH4V TGCA 1 cut(s) 35
HpyF10VI GCNNNNNNNGC 1 cut(s) 127
HpyF3I CTNAG 1 cut(s) 132
LmnI GCTCC 1 cut(s) 147
LpnPI CCDG 5 cut(s) 76, 103, 107, 114, 179
MaeI CTAG 1 cut(s) 69
MaeIII GTNAC 2 cut(s) 74, 157
MboII GAAGA 1 cut(s) 176
MnlI CCTC 6 cut(s) 18, 55, 63, 65, 93, 141
Mph1103I ATGCAT 1 cut(s) 37
MspR9I CCNGG 1 cut(s) 91
Mva1269I GAATGC 1 cut(s) 37
MvaI CCWGG 1 cut(s) 91
MwoI GCNNNNNNNGC 1 cut(s) 127
NlaIV GGNNCC 1 cut(s) 126
NsiI ATGCAT 1 cut(s) 37
PctI GAATGC 1 cut(s) 37
PfoI TCCNGGA 1 cut(s) 89
Psp6I CCWGG 1 cut(s) 89
PspGI CCWGG 1 cut(s) 89
PspN4I GGNNCC 1 cut(s) 126
ScrFI CCNGG 1 cut(s) 91
SetI ASST 3 cut(s) 76, 138, 180
SsiI CCGC 1 cut(s) 128
SspMI CTAG 1 cut(s) 69
StyD4I CCNGG 1 cut(s) 89
TaaI ACNGT 1 cut(s) 109
XspI CTAG 1 cut(s) 69
Zsp2I ATGCAT 1 cut(s) 37
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.