Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006626.1

Orthogroup ID

OG0003892

Physical Location & Seq

Genomic Coordinates Forward (+)

8081 .. 8746

Gene Structure 666 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006626.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 666 bp

atggaactgttacccgatcagaggagggctcgtaagaagatgtatcgagatcgaaagatgaatctatttaaaaagggggaggagctttctatactttgtggtaccgatgtccttgtgatcctgttccaaccaactgacaagggtactactagtcagccagctgctgagacttggcctaaagatcccacagaagtcgaacgcattatccgcagatacaaggcaaagcttgcagcctccactcatgcttcatctcctagaacaagcgtgctggcaatcaaagataagtctactagtactcctccatcttcatctccatctccatctccatctccatctcgaagtgtaccagagaagagaaaatacatgaacttagatttgtctttgtccggttcttacgattcccaaacgaaaaagttgaaagaggacaagggtaagaagaagttgcatgcttgggatgatgatgagaatataaattcacaagaggccggcatggagatgcagctcaagtatccaacaatctgggatcatgctgcaagagaaaatttatacgacgacggggaattgatgattggatatgatgatcatcaagcaaaacttgcttcattggaagctaagcaaaaagctataacaaaaagaattgcttcattggaggcaactcatgcttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003006 GO:0003674 GO:0003700 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006355 GO:0007275 GO:0008150 GO:0009790 GO:0009791 GO:0009793 GO:0009889 GO:0010154 GO:0010468 GO:0010556 GO:0019219 GO:0019222 GO:0022414 GO:0031323 GO:0031326 GO:0032501 GO:0032502 GO:0042995 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0048316 GO:0048608 GO:0048731 GO:0048856 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0061458 GO:0065007 GO:0080090 GO:0090406 GO:0120025 GO:0140110 GO:1903506 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

SRF-TF

Protein Analysis

221

Amino Acids

24.92

Weight (kDa)

9.2

Isoelectric Point (pI)

54.99

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003892)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G13470
fragaria_vesca	FvH4_7g01990 FvH4_7g02000 FvH4_7g02110
malus_domestica	MD02G1298000.v1.1 MD07G1026200.v1.1
prunus_persica	Prupe.2G026400_v2.0.a1 Prupe.2G026400_v2.0.a1 Prupe.2G026400_v2.0.a1 Prupe.2G026400_v2.0.a1
pyrus_communis	pycom02g25090
rosa_chinensis	RchiOBHm_Chr1g0318991
rosa_laevigata	RLG00000030489 RLG00000030510 RLG00000030511
rosa_multiflora	Rmu_sc0003503.1_g000002 Rmu_sc0005870.1_g000006 Rmu_sc0006626.1_g000002 Rmu_sc0006626.1_g000003
rosa_roxburghii	Rroxscaffold_4G00328700
rosa_rugosa	Rorug01G0026300 Rorug01G0027300
rosa_samantha	Rh1AG038100 Rh1AG038200 Rh1AG039600 Rh1AG263000 Rh1BG034400 Rh1BG034500 Rh1BG036400 Rh1CG037100 Rh1DG032900 Rh1DG033000
rosa_wichuraiana	Rw1G002940 Rw1G002950

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	101
AccB1I	GGYRCC	1 cut(s)	101
AccI	GTMKAC	1 cut(s)	287
AciI	CCGC	1 cut(s)	208
AclWI	GGATC	3 cut(s)	112, 176, 531
AcsI	RAATTY	2 cut(s)	472, 541
AfaI	GTAC	4 cut(s)	103, 145, 295, 345
AfiI	CCNNNNNNNGG	1 cut(s)	21
AgsI	TTSAA	1 cut(s)	418
AhlI	ACTAGT	2 cut(s)	149, 290
AjuI	GAANNNNNNNTTGG	2 cut(s)	552, 584
AloI	GAACNNNNNNTCC	2 cut(s)	189, 221
AluBI	AGCT	6 cut(s)	85, 161, 226, 502, 611, 623
AluI	AGCT	6 cut(s)	85, 161, 226, 502, 611, 623
Alw26I	GTCTC	1 cut(s)	161
AlwI	GGATC	3 cut(s)	112, 176, 531
AlwNI	CAGNNNCTG	1 cut(s)	164
AoxI	GGCC	2 cut(s)	173, 483
ApeKI	GCWGC	4 cut(s)	161, 230, 499, 530
ApoI	RAATTY	2 cut(s)	472, 541
Asp700I	GAANNNNTTC	1 cut(s)	640
Asp718I	GGTACC	1 cut(s)	101
BaeI	ACNNNNGTAYC	2 cut(s)	93, 126
BanI	GGYRCC	1 cut(s)	101
BanII	GRGCYC	1 cut(s)	31
BarI	GAAGNNNNNNTAC	2 cut(s)	344, 376
BbvI	GCAGC	4 cut(s)	148, 242, 511, 517
BccI	CCATC	5 cut(s)	310, 322, 328, 334, 340
BciVI	GTATCC	1 cut(s)	519
BclI	TGATCA	1 cut(s)	580
BcoDI	GTCTC	1 cut(s)	161
BcuI	ACTAGT	2 cut(s)	149, 290
BfaI	CTAG	3 cut(s)	150, 255, 291
BfuI	GTATCC	1 cut(s)	519
BisI	GCNGC	4 cut(s)	162, 231, 500, 531
BlpI	GCTNAGC	1 cut(s)	612
BlsI	GCNGC	4 cut(s)	163, 232, 501, 532
BmcAI	AGTACT	1 cut(s)	295
BmiI	GGNNCC	1 cut(s)	103
BmsI	GCATC	1 cut(s)	486
BplI	GAGNNNNNCTC	2 cut(s)	13, 45
Bpu1102I	GCTNAGC	1 cut(s)	612
BpuEI	CTTGAG	1 cut(s)	488
BsaBI	GATNNNNATC	1 cut(s)	582
BsaWI	WCCGGW	1 cut(s)	386
BsaXI	ACNNNNNCTCC	4 cut(s)	16, 46, 280, 310
Bsc4I	CCNNNNNNNGG	1 cut(s)	21
Bse118I	RCCGGY	1 cut(s)	485
Bse8I	GATNNNNATC	1 cut(s)	582
BseGI	GGATG	1 cut(s)	460
BseJI	GATNNNNATC	1 cut(s)	582
BseLI	CCNNNNNNNGG	1 cut(s)	21
BseMII	CTCAG	1 cut(s)	156
BseRI	GAGGAG	3 cut(s)	37, 95, 288
BseXI	GCAGC	4 cut(s)	148, 242, 511, 517
BshFI	GGCC	2 cut(s)	175, 485
BshNI	GGYRCC	1 cut(s)	101
BsiSI	CCGG	2 cut(s)	387, 486
BslI	CCNNNNNNNGG	1 cut(s)	21
BsmAI	GTCTC	1 cut(s)	161
BsnI	GGCC	2 cut(s)	175, 485
Bsp1286I	GDGCHC	1 cut(s)	31
Bsp143I	GATC	6 cut(s)	16, 49, 117, 181, 523, 580
Bsp1720I	GCTNAGC	1 cut(s)	612
BspACI	CCGC	1 cut(s)	208
BspANI	GGCC	2 cut(s)	175, 485
BspCNI	CTCAG	1 cut(s)	157
BspLI	GGNNCC	1 cut(s)	103
BspPI	GGATC	3 cut(s)	112, 176, 531
BspT107I	GGYRCC	1 cut(s)	101
BsrFI	RCCGGY	1 cut(s)	485
BssAI	RCCGGY	1 cut(s)	485
BssMI	GATC	6 cut(s)	16, 49, 117, 181, 523, 580
Bst4CI	ACNGT	1 cut(s)	9
Bst6I	CTCTTC	1 cut(s)	347
BstAPI	GCANNNNNTGC	3 cut(s)	227, 596, 659
BstC8I	GCNNGC	6 cut(s)	159, 228, 266, 270, 447, 487
BstDEI	CTNAG	3 cut(s)	165, 370, 612
BstF5I	GGATG	1 cut(s)	460
BstKTI	GATC	6 cut(s)	19, 52, 120, 184, 526, 583
BstMAI	GTCTC	1 cut(s)	161
BstMBI	GATC	6 cut(s)	16, 49, 117, 181, 523, 580
BstMWI	GCNNNNNNNGC	4 cut(s)	207, 227, 596, 659
BstNSI	RCATGY	1 cut(s)	449
BstV1I	GCAGC	4 cut(s)	148, 242, 511, 517
BstX2I	RGATCY	1 cut(s)	181
BstXI	CCANNNNNNTGG	1 cut(s)	519
BstYI	RGATCY	1 cut(s)	181
BsuI	GTATCC	1 cut(s)	519
BsuRI	GGCC	2 cut(s)	175, 485
BtsCI	GGATG	1 cut(s)	460
Cac8I	GCNNGC	6 cut(s)	159, 228, 266, 270, 447, 487
CaiI	CAGNNNCTG	1 cut(s)	164
Cfr10I	RCCGGY	1 cut(s)	485
Csp6I	GTAC	4 cut(s)	102, 144, 294, 344
CviAII	CATG	6 cut(s)	242, 364, 446, 490, 527, 659
CviQI	GTAC	4 cut(s)	102, 144, 294, 344
DdeI	CTNAG	3 cut(s)	165, 370, 612
DpnI	GATC	6 cut(s)	18, 51, 119, 183, 525, 582
DpnII	GATC	6 cut(s)	16, 49, 117, 181, 523, 580
DraI	TTTAAA	1 cut(s)	70
Eam1104I	CTCTTC	1 cut(s)	347
EarI	CTCTTC	1 cut(s)	347
Eco24I	GRGCYC	1 cut(s)	31
EcoT38I	GRGCYC	1 cut(s)	31
FaeI	CATG	6 cut(s)	245, 367, 449, 493, 530, 662
FalI	AAGNNNNNCTT	4 cut(s)	579, 611, 625, 657
FatI	CATG	6 cut(s)	241, 363, 445, 489, 526, 658
FbaI	TGATCA	1 cut(s)	580
FblI	GTMKAC	1 cut(s)	287
Fnu4HI	GCNGC	4 cut(s)	162, 231, 500, 531
FokI	GGATG	1 cut(s)	467
FriOI	GRGCYC	1 cut(s)	31
Fsp4HI	GCNGC	4 cut(s)	162, 231, 500, 531
FspBI	CTAG	3 cut(s)	150, 255, 291
GluI	GCNGC	4 cut(s)	162, 231, 500, 531
HaeIII	GGCC	2 cut(s)	175, 485
HapII	CCGG	2 cut(s)	387, 486
Hin1II	CATG	6 cut(s)	245, 367, 449, 493, 530, 662
HindIII	AAGCTT	1 cut(s)	224
HinfI	GANTC	2 cut(s)	61, 398
HpaII	CCGG	2 cut(s)	387, 486
Hpy166II	GTNNAC	2 cut(s)	288, 344
Hpy188I	TCNGA	1 cut(s)	21
Hpy188III	TCNNGA	2 cut(s)	47, 336
Hpy8I	GTNNAC	2 cut(s)	288, 344
Hpy99I	CGWCG	2 cut(s)	554, 557
HpyCH4III	ACNGT	1 cut(s)	9
HpyCH4V	TGCA	4 cut(s)	230, 445, 499, 533
HpyF10VI	GCNNNNNNNGC	4 cut(s)	207, 227, 596, 659
HpyF3I	CTNAG	3 cut(s)	165, 370, 612
Hsp92II	CATG	6 cut(s)	245, 367, 449, 493, 530, 662
KpnI	GGTACC	1 cut(s)	105
KroI	GCCGGC	1 cut(s)	485
KroNI	GCCGGC	1 cut(s)	487
Ksp22I	TGATCA	1 cut(s)	580
Kzo9I	GATC	6 cut(s)	16, 49, 117, 181, 523, 580
LmnI	GCTCC	1 cut(s)	82
LpnPI	CCDG	7 cut(s)	134, 171, 254, 360, 400, 499, 505
Lsp1109I	GCAGC	4 cut(s)	148, 242, 511, 517
LweI	GCATC	1 cut(s)	486
MaeI	CTAG	3 cut(s)	150, 255, 291
MaeIII	GTNAC	1 cut(s)	9
MalI	GATC	6 cut(s)	18, 51, 119, 183, 525, 582
MboI	GATC	6 cut(s)	16, 49, 117, 181, 523, 580
MboII	GAAGA	4 cut(s)	49, 297, 364, 448
MflI	RGATCY	1 cut(s)	181
MhlI	GDGCHC	1 cut(s)	31
MluCI	AATT	4 cut(s)	472, 541, 560, 636
MmeI	TCCRAC	2 cut(s)	151, 536
MnlI	CCTC	8 cut(s)	15, 18, 73, 244, 309, 415, 475, 643
MroNI	GCCGGC	1 cut(s)	485
MroXI	GAANNNNTTC	1 cut(s)	640
MseI	TTAA	2 cut(s)	69, 664
MslI	CAYNNNNRTG	1 cut(s)	494
MspA1I	CMGCKG	1 cut(s)	161
MspI	CCGG	2 cut(s)	387, 486
MwoI	GCNNNNNNNGC	4 cut(s)	207, 227, 596, 659
NaeI	GCCGGC	1 cut(s)	487
NdeII	GATC	6 cut(s)	16, 49, 117, 181, 523, 580
NgoMIV	GCCGGC	1 cut(s)	485
NlaIII	CATG	6 cut(s)	245, 367, 449, 493, 530, 662
NlaIV	GGNNCC	1 cut(s)	103
NspI	RCATGY	1 cut(s)	449
PaeI	GCATGC	1 cut(s)	449
PdiI	GCCGGC	1 cut(s)	487
PdmI	GAANNNNTTC	1 cut(s)	640
PfeI	GAWTC	2 cut(s)	61, 398
PkrI	GCNGC	4 cut(s)	163, 232, 501, 532
PspN4I	GGNNCC	1 cut(s)	103
PstNI	CAGNNNCTG	1 cut(s)	164
PsuI	RGATCY	1 cut(s)	181
PvuII	CAGCTG	1 cut(s)	161
RsaI	GTAC	4 cut(s)	103, 145, 295, 345
RsaNI	GTAC	4 cut(s)	102, 144, 294, 344
RseI	CAYNNNNRTG	1 cut(s)	494
SaqAI	TTAA	2 cut(s)	69, 664
SatI	GCNGC	4 cut(s)	162, 231, 500, 531
Sau3AI	GATC	6 cut(s)	16, 49, 117, 181, 523, 580
ScaI	AGTACT	1 cut(s)	295
SduI	GDGCHC	1 cut(s)	31
SetI	ASST	6 cut(s)	87, 163, 228, 504, 613, 625
SfaNI	GCATC	1 cut(s)	486
SmiMI	CAYNNNNRTG	1 cut(s)	494
SmlI	CTYRAG	1 cut(s)	503
SmoI	CTYRAG	1 cut(s)	503
SpeI	ACTAGT	2 cut(s)	149, 290
SphI	GCATGC	1 cut(s)	449
Sse9I	AATT	4 cut(s)	472, 541, 560, 636
SsiI	CCGC	1 cut(s)	208
SspMI	CTAG	3 cut(s)	150, 255, 291
TaaI	ACNGT	1 cut(s)	9
TaqI	TCGA	4 cut(s)	46, 52, 195, 337
TasI	AATT	4 cut(s)	472, 541, 560, 636
TatI	WGTACW	1 cut(s)	293
TfiI	GAWTC	2 cut(s)	61, 398
Tru1I	TTAA	2 cut(s)	69, 664
Tru9I	TTAA	2 cut(s)	69, 664
TseI	GCWGC	4 cut(s)	161, 230, 499, 530
TspDTI	ATGAA	6 cut(s)	74, 237, 297, 380, 591, 633
XapI	RAATTY	2 cut(s)	472, 541
XceI	RCATGY	1 cut(s)	449
XmiI	GTMKAC	1 cut(s)	287
XmnI	GAANNNNTTC	1 cut(s)	640
XspI	CTAG	3 cut(s)	150, 255, 291
ZrmI	AGTACT	1 cut(s)	295

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.