Rmu_sc0003503.1_g000002

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003503.1
Physical Location & Seq
Reverse (-)
8195 .. 10983
2789 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003503.1_g000002.1.cds

Sequence Viewer

Length: 498 bp
atgtcactggtggactacgcatcttcagacgacgacgtttcagaggaggaagaagataaagagaacaaggaaaacgaaccagcccaagtagccatggatgaaccccaccctccgactcgtcctcctcacacccaatctgttgtttcgtcatatcagcagcctgaaagtactgcttatacatcagctccttcagtcgagaaacttcctgatgcttcacaactctttggttcttctgagttctcatccaatatgctgagtggtaactaccagtcttctcttgttggagctgaaagtgcatcacgcaaaagagagtcaaattcctttgcttcccctattcctcgcagtaaagttcctagaggtaacttgccccattccaggaatgttccagatacacttggtggtatgctggttccacctcagcttagtggaaggagcaatgttgtcacagaagatgttagcaagctatttgtcaaaaagcaaggaggttcaccacagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

165

Amino Acids

17.79

Weight (kDa)

4.86

Isoelectric Point (pI)

72.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 316
AcuI CTGAAG 2 cut(s) 9, 174
AdeI CACNNNGTG 1 cut(s) 398
AfaI GTAC 1 cut(s) 169
AfiI CCNNNNNNNGG 1 cut(s) 375
AjnI CCWGG 1 cut(s) 374
AluBI AGCT 4 cut(s) 185, 287, 421, 463
AluI AGCT 4 cut(s) 185, 287, 421, 463
ApeKI GCWGC 1 cut(s) 157
ApoI RAATTY 1 cut(s) 316
AsuHPI GGTGA 1 cut(s) 480
BbsI GAAGAC 1 cut(s) 264
BbvCI CCTCAGC 1 cut(s) 417
BbvI GCAGC 1 cut(s) 169
BciT130I CCWGG 1 cut(s) 376
BfaI CTAG 1 cut(s) 354
BisI GCNGC 1 cut(s) 158
BlsI GCNGC 1 cut(s) 159
BmcAI AGTACT 1 cut(s) 169
Bme1390I CCNGG 1 cut(s) 376
BmiI GGNNCC 1 cut(s) 411
BmrFI CCNGG 1 cut(s) 376
BmsI GCATC 3 cut(s) 29, 199, 305
BpiI GAAGAC 1 cut(s) 264
Bpu10I CCTNAGC 1 cut(s) 417
BsaJI CCNNGG 1 cut(s) 93
BsaXI ACNNNNNCTCC 4 cut(s) 106, 136, 169, 199
Bsc4I CCNNNNNNNGG 1 cut(s) 375
Bse1I ACTGG 2 cut(s) 12, 268
Bse3DI GCAATG 1 cut(s) 442
BseBI CCWGG 1 cut(s) 376
BseDI CCNNGG 1 cut(s) 93
BseGI GGATG 2 cut(s) 103, 242
BseLI CCNNNNNNNGG 1 cut(s) 375
BseMI GCAATG 1 cut(s) 442
BseMII CTCAG 3 cut(s) 225, 245, 431
BseNI ACTGG 2 cut(s) 12, 268
BseRI GAGGAG 2 cut(s) 59, 114
BseXI GCAGC 1 cut(s) 169
BslI CCNNNNNNNGG 1 cut(s) 375
Bsp19I CCATGG 1 cut(s) 93
BspCNI CTCAG 3 cut(s) 226, 246, 430
BspLI GGNNCC 1 cut(s) 411
BsrDI GCAATG 1 cut(s) 442
BsrI ACTGG 2 cut(s) 12, 268
BssECI CCNNGG 1 cut(s) 93
BssT1I CCWWGG 1 cut(s) 93
Bst2UI CCWGG 1 cut(s) 376
Bst4CI ACNGT 1 cut(s) 495
BstC8I GCNNGC 1 cut(s) 461
BstDEI CTNAG 4 cut(s) 234, 254, 417, 422
BstDSI CCRYGG 1 cut(s) 93
BstF5I GGATG 2 cut(s) 103, 242
BstMWI GCNNNNNNNGC 2 cut(s) 89, 293
BstNI CCWGG 1 cut(s) 376
BstSCI CCNGG 1 cut(s) 374
BstV1I GCAGC 1 cut(s) 169
BstV2I GAAGAC 1 cut(s) 264
BtgI CCRYGG 1 cut(s) 93
BtsCI GGATG 2 cut(s) 103, 242
BtsIMutI CAGTG 1 cut(s) 5
Cac8I GCNNGC 1 cut(s) 461
Csp6I GTAC 1 cut(s) 168
CviAII CATG 1 cut(s) 94
CviJI RGCY 7 cut(s) 83, 92, 160, 185, 287, 421, 463
CviKI_1 RGCY 7 cut(s) 83, 92, 160, 185, 287, 421, 463
CviQI GTAC 1 cut(s) 168
DdeI CTNAG 4 cut(s) 234, 254, 417, 422
DraIII CACNNNGTG 1 cut(s) 398
Eco130I CCWWGG 1 cut(s) 93
Eco57I CTGAAG 2 cut(s) 9, 174
EcoRII CCWGG 1 cut(s) 374
EcoT14I CCWWGG 1 cut(s) 93
ErhI CCWWGG 1 cut(s) 93
FaeI CATG 1 cut(s) 97
FaiI YATR 5 cut(s) 95, 151, 177, 251, 404
FalI AAGNNNNNCTT 2 cut(s) 157, 189
FatI CATG 1 cut(s) 93
Fnu4HI GCNGC 1 cut(s) 158
FokI GGATG 2 cut(s) 110, 229
Fsp4HI GCNGC 1 cut(s) 158
FspBI CTAG 1 cut(s) 354
GluI GCNGC 1 cut(s) 158
Hin1II CATG 1 cut(s) 97
HinfI GANTC 2 cut(s) 115, 311
HphI GGTGA 1 cut(s) 480
Hpy166II GTNNAC 2 cut(s) 13, 488
Hpy188I TCNGA 4 cut(s) 28, 43, 114, 235
Hpy188III TCNNGA 3 cut(s) 196, 206, 386
Hpy8I GTNNAC 2 cut(s) 13, 488
Hpy99I CGWCG 2 cut(s) 35, 38
HpyAV CCTTC 2 cut(s) 198, 423
HpyCH4III ACNGT 1 cut(s) 495
HpyCH4IV ACGT 1 cut(s) 36
HpyCH4V TGCA 1 cut(s) 296
HpyF10VI GCNNNNNNNGC 2 cut(s) 89, 293
HpyF3I CTNAG 4 cut(s) 234, 254, 417, 422
HpySE526I ACGT 1 cut(s) 36
Hsp92II CATG 1 cut(s) 97
LmnI GCTCC 3 cut(s) 190, 284, 432
LpnPI CCDG 8 cut(s) 93, 174, 219, 281, 361, 388, 392, 399
Lsp1109I GCAGC 1 cut(s) 169
LweI GCATC 3 cut(s) 29, 199, 305
MaeI CTAG 1 cut(s) 354
MaeII ACGT 1 cut(s) 36
MaeIII GTNAC 4 cut(s) 3, 260, 359, 442
MboII GAAGA 6 cut(s) 15, 62, 65, 222, 264, 461
MluCI AATT 1 cut(s) 316
MlyI GAGTC 2 cut(s) 109, 320
MmeI TCCRAC 2 cut(s) 137, 262
MnlI CCTC 9 cut(s) 37, 40, 120, 132, 135, 348, 350, 426, 476
MspR9I CCNGG 1 cut(s) 376
MvaI CCWGG 1 cut(s) 376
MwoI GCNNNNNNNGC 2 cut(s) 89, 293
NcoI CCATGG 1 cut(s) 93
NlaIII CATG 1 cut(s) 97
NlaIV GGNNCC 1 cut(s) 411
NmuCI GTSAC 2 cut(s) 3, 442
PfoI TCCNGGA 1 cut(s) 374
PkrI GCNGC 1 cut(s) 159
PleI GAGTC 2 cut(s) 109, 319
PpsI GAGTC 2 cut(s) 109, 319
Psp6I CCWGG 1 cut(s) 374
PspGI CCWGG 1 cut(s) 374
PspN4I GGNNCC 1 cut(s) 411
RsaI GTAC 1 cut(s) 169
RsaNI GTAC 1 cut(s) 168
SatI GCNGC 1 cut(s) 158
ScaI AGTACT 1 cut(s) 169
SchI GAGTC 2 cut(s) 109, 320
ScrFI CCNGG 1 cut(s) 376
SetI ASST 8 cut(s) 39, 187, 289, 361, 418, 423, 465, 487
SfaNI GCATC 3 cut(s) 29, 199, 305
Sse9I AATT 1 cut(s) 316
SspMI CTAG 1 cut(s) 354
StyD4I CCNGG 1 cut(s) 374
StyI CCWWGG 1 cut(s) 93
TaaI ACNGT 1 cut(s) 495
TaiI ACGT 1 cut(s) 39
TaqI TCGA 1 cut(s) 195
TasI AATT 1 cut(s) 316
TatI WGTACW 1 cut(s) 167
TscAI CASTG 1 cut(s) 12
TseFI GTSAC 2 cut(s) 3, 442
TseI GCWGC 1 cut(s) 157
Tsp45I GTSAC 2 cut(s) 3, 442
TspDTI ATGAA 1 cut(s) 114
TspRI CASTG 1 cut(s) 12
XapI RAATTY 1 cut(s) 316
XspI CTAG 1 cut(s) 354
ZrmI AGTACT 1 cut(s) 169
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.