pycom04g00890

This protein promotes the GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes during protein biosynthesis

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
Physical Location & Seq
Reverse (-)
764711 .. 765034
324 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g00890.1

Sequence Viewer

Length: 324 bp
ATGAACAAAAGGTCGTTCAAGTATGCCTGGGTGCTTGACAAGCTTAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCTTGTGGAAGTTTGAGACCACAAAGTACTATTGCACAGTCATTGATGCTCCGGGGCATCGTGATTTCATTAAGAATATGATTACTGGAACTTCACAGGCTGACTGTGCTGTCCTCATCATTGACTCCACCACTGGTGGTTTTGAAGCTGGTATTTCCAAGGATGGACAGACCCGTGAGCATGCTCTTCTTGCTTTCACCCTCGGTGTGAAGCAGATGATTTGTTGCTGTAACAAGGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

108

Amino Acids

12.01

Weight (kDa)

8.63

Isoelectric Point (pI)

25.48

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GTP_EFTU PF00009 8 - 107 8e-33 Elongation factor Tu GTP binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 191
AfaI GTAC 1 cut(s) 110
AflII CTTAAG 1 cut(s) 44
AgsI TTSAA 2 cut(s) 19, 227
AjnI CCWGG 1 cut(s) 26
AluBI AGCT 2 cut(s) 43, 230
AluI AGCT 2 cut(s) 43, 230
Alw26I GTCTC 1 cut(s) 92
AoxI GGCC 1 cut(s) 48
AsuC2I CCSGG 1 cut(s) 135
AsuHPI GGTGA 2 cut(s) 61, 271
BccI CCATC 1 cut(s) 239
BciT130I CCWGG 1 cut(s) 28
BcnI CCSGG 1 cut(s) 135
BcoDI GTCTC 1 cut(s) 92
BfrI CTTAAG 1 cut(s) 44
BmcAI AGTACT 1 cut(s) 110
Bme1390I CCNGG 2 cut(s) 28, 135
BmrFI CCNGG 2 cut(s) 28, 135
BmsI GCATC 2 cut(s) 118, 148
BpuMI CCSGG 1 cut(s) 135
BsaI GGTCTC 1 cut(s) 92
BsaJI CCNNGG 4 cut(s) 27, 134, 240, 283
Bse1I ACTGG 2 cut(s) 172, 220
BseBI CCWGG 1 cut(s) 28
BseDI CCNNGG 4 cut(s) 27, 134, 240, 283
BseGI GGATG 1 cut(s) 250
BseNI ACTGG 2 cut(s) 172, 220
BshFI GGCC 1 cut(s) 50
BsiSI CCGG 1 cut(s) 134
BsmAI GTCTC 1 cut(s) 92
BsnI GGCC 1 cut(s) 50
Bso31I GGTCTC 1 cut(s) 92
BspANI GGCC 1 cut(s) 50
BspQI GCTCTTC 1 cut(s) 273
BspTI CTTAAG 1 cut(s) 44
BspTNI GGTCTC 1 cut(s) 92
BsrI ACTGG 2 cut(s) 172, 220
BssECI CCNNGG 4 cut(s) 27, 134, 240, 283
BssT1I CCWWGG 1 cut(s) 240
Bst2UI CCWGG 1 cut(s) 28
Bst4CI ACNGT 2 cut(s) 121, 188
Bst6I CTCTTC 1 cut(s) 273
BstAFI CTTAAG 1 cut(s) 44
BstC8I GCNNGC 1 cut(s) 264
BstF5I GGATG 1 cut(s) 250
BstMAI GTCTC 1 cut(s) 92
BstMWI GCNNNNNNNGC 3 cut(s) 40, 188, 272
BstNI CCWGG 1 cut(s) 28
BstNSI RCATGY 1 cut(s) 266
BstSCI CCNGG 2 cut(s) 26, 133
BsuRI GGCC 1 cut(s) 50
BtsCI GGATG 1 cut(s) 250
BtsIMutI CAGTG 1 cut(s) 213
Cac8I GCNNGC 1 cut(s) 264
Csp6I GTAC 1 cut(s) 109
CviAII CATG 1 cut(s) 263
CviJI RGCY 4 cut(s) 43, 50, 182, 230
CviKI_1 RGCY 4 cut(s) 43, 50, 182, 230
CviQI GTAC 1 cut(s) 109
DrdI GACNNNNNNGTC 1 cut(s) 191
DseDI GACNNNNNNGTC 1 cut(s) 191
Eam1104I CTCTTC 1 cut(s) 273
EarI CTCTTC 1 cut(s) 273
Eco130I CCWWGG 1 cut(s) 240
Eco31I GGTCTC 1 cut(s) 92
Eco32I GATATC 1 cut(s) 79
EcoRII CCWGG 1 cut(s) 26
EcoRV GATATC 1 cut(s) 79
EcoT14I CCWWGG 1 cut(s) 240
ErhI CCWWGG 1 cut(s) 240
FaeI CATG 1 cut(s) 266
FaiI YATR 4 cut(s) 24, 161, 264, 322
FatI CATG 1 cut(s) 262
FokI GGATG 1 cut(s) 257
HaeIII GGCC 1 cut(s) 50
HapII CCGG 1 cut(s) 134
Hin1II CATG 1 cut(s) 266
HindIII AAGCTT 1 cut(s) 41
HinfI GANTC 1 cut(s) 206
HpaII CCGG 1 cut(s) 134
HphI GGTGA 2 cut(s) 61, 271
Hpy188III TCNNGA 1 cut(s) 143
HpyCH4III ACNGT 2 cut(s) 121, 188
HpyCH4V TGCA 1 cut(s) 117
HpyF10VI GCNNNNNNNGC 3 cut(s) 40, 188, 272
Hsp92II CATG 1 cut(s) 266
LguI GCTCTTC 1 cut(s) 273
LmnI GCTCC 1 cut(s) 136
LpnPI CCDG 7 cut(s) 13, 40, 147, 153, 164, 201, 216
LweI GCATC 2 cut(s) 118, 148
MaeIII GTNAC 1 cut(s) 311
MboII GAAGA 1 cut(s) 260
MlyI GAGTC 1 cut(s) 200
MnlI CCTC 2 cut(s) 206, 293
MseI TTAA 2 cut(s) 45, 153
MspCI CTTAAG 1 cut(s) 44
MspI CCGG 1 cut(s) 134
MspR9I CCNGG 2 cut(s) 28, 135
MvaI CCWGG 1 cut(s) 28
MwoI GCNNNNNNNGC 3 cut(s) 40, 188, 272
NciI CCSGG 1 cut(s) 135
NlaIII CATG 1 cut(s) 266
NmeAIII GCCGAG 1 cut(s) 76
NspI RCATGY 1 cut(s) 266
PaeI GCATGC 1 cut(s) 266
PciSI GCTCTTC 1 cut(s) 273
PleI GAGTC 1 cut(s) 200
PpsI GAGTC 1 cut(s) 200
Psp6I CCWGG 1 cut(s) 26
PspGI CCWGG 1 cut(s) 26
RsaI GTAC 1 cut(s) 110
RsaNI GTAC 1 cut(s) 109
SapI GCTCTTC 1 cut(s) 273
SaqAI TTAA 2 cut(s) 45, 153
ScaI AGTACT 1 cut(s) 110
SchI GAGTC 1 cut(s) 200
ScrFI CCNGG 2 cut(s) 28, 135
SetI ASST 4 cut(s) 14, 45, 232, 321
SfaNI GCATC 2 cut(s) 118, 148
SmlI CTYRAG 1 cut(s) 44
SmoI CTYRAG 1 cut(s) 44
SphI GCATGC 1 cut(s) 266
StyD4I CCNGG 2 cut(s) 26, 133
StyI CCWWGG 1 cut(s) 240
TaaI ACNGT 2 cut(s) 121, 188
TatI WGTACW 1 cut(s) 108
Tru1I TTAA 2 cut(s) 45, 153
Tru9I TTAA 2 cut(s) 45, 153
TscAI CASTG 1 cut(s) 220
TspDTI ATGAA 2 cut(s) 17, 139
TspRI CASTG 1 cut(s) 220
Vha464I CTTAAG 1 cut(s) 44
XceI RCATGY 1 cut(s) 266
ZrmI AGTACT 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.