pycom07g17750

Belongs to the chalcone isomerase family

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
Physical Location & Seq
Reverse (-)
20280396 .. 20280587
192 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g17750.1

Sequence Viewer

Length: 192 bp
ATGGAGAATAAACTACTCGGAGAGGCAATTCTGGAGTCGATCATCGGAAAGCACGGTGTTTCGCCAGCGGCAAGGCAAAGCTTGGCCGAGAGGTTATCGGATTTGTTGACTGAGAAGCCTGAACTGTTGGGGGTTGGAAAGGCCACAAACCAAGTTGAGGTTGGGGCAACTGATCAGAGAGAAGAGAAATGA

Protein Analysis

64

Amino Acids

6.77

Weight (kDa)

5.03

Isoelectric Point (pI)

33.86

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Chalcone PF02431 1 - 35 4e-12 Chalcone-flavanone isomerase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 68
AcoI YGGCCR 1 cut(s) 84
AfiI CCNNNNNNNGG 1 cut(s) 157
AluBI AGCT 1 cut(s) 81
AluI AGCT 1 cut(s) 81
AoxI GGCC 2 cut(s) 84, 141
BclI TGATCA 1 cut(s) 172
BisI GCNGC 1 cut(s) 69
BlsI GCNGC 1 cut(s) 70
BpmI CTGGAG 1 cut(s) 53
Bsc4I CCNNNNNNNGG 1 cut(s) 157
BseLI CCNNNNNNNGG 1 cut(s) 157
BseMII CTCAG 1 cut(s) 102
BshFI GGCC 2 cut(s) 86, 143
BslI CCNNNNNNNGG 1 cut(s) 157
BsnI GGCC 2 cut(s) 86, 143
Bsp143I GATC 2 cut(s) 39, 172
BspACI CCGC 1 cut(s) 68
BspANI GGCC 2 cut(s) 86, 143
BspCNI CTCAG 1 cut(s) 103
BssMI GATC 2 cut(s) 39, 172
Bst4CI ACNGT 2 cut(s) 56, 126
Bst6I CTCTTC 1 cut(s) 177
BstC8I GCNNGC 1 cut(s) 66
BstDEI CTNAG 1 cut(s) 111
BstKTI GATC 2 cut(s) 42, 175
BstMBI GATC 2 cut(s) 39, 172
BsuRI GGCC 2 cut(s) 86, 143
Cac8I GCNNGC 1 cut(s) 66
CviJI RGCY 4 cut(s) 81, 86, 118, 143
CviKI_1 RGCY 4 cut(s) 81, 86, 118, 143
DdeI CTNAG 1 cut(s) 111
DpnI GATC 2 cut(s) 41, 174
DpnII GATC 2 cut(s) 39, 172
EaeI YGGCCR 1 cut(s) 84
Eam1104I CTCTTC 1 cut(s) 177
EarI CTCTTC 1 cut(s) 177
FbaI TGATCA 1 cut(s) 172
Fnu4HI GCNGC 1 cut(s) 69
Fsp4HI GCNGC 1 cut(s) 69
GluI GCNGC 1 cut(s) 69
GsuI CTGGAG 1 cut(s) 53
HaeIII GGCC 2 cut(s) 86, 143
HincII GTYRAC 1 cut(s) 108
HindII GTYRAC 1 cut(s) 108
HindIII AAGCTT 1 cut(s) 79
HinfI GANTC 1 cut(s) 35
Hpy166II GTNNAC 1 cut(s) 108
Hpy188I TCNGA 4 cut(s) 20, 47, 100, 177
Hpy188III TCNNGA 1 cut(s) 32
Hpy8I GTNNAC 1 cut(s) 108
HpyCH4III ACNGT 2 cut(s) 56, 126
HpyF3I CTNAG 1 cut(s) 111
Ksp22I TGATCA 1 cut(s) 172
Kzo9I GATC 2 cut(s) 39, 172
LpnPI CCDG 3 cut(s) 17, 78, 132
MalI GATC 2 cut(s) 41, 174
MboI GATC 2 cut(s) 39, 172
MluCI AATT 1 cut(s) 27
MlyI GAGTC 1 cut(s) 44
MmeI TCCRAC 1 cut(s) 115
MnlI CCTC 3 cut(s) 16, 84, 151
MspA1I CMGCKG 1 cut(s) 68
NdeII GATC 2 cut(s) 39, 172
NmeAIII GCCGAG 1 cut(s) 112
PkrI GCNGC 1 cut(s) 70
PleI GAGTC 1 cut(s) 43
PpsI GAGTC 1 cut(s) 43
SatI GCNGC 1 cut(s) 69
Sau3AI GATC 2 cut(s) 39, 172
SchI GAGTC 1 cut(s) 44
SetI ASST 3 cut(s) 83, 95, 162
SgeI CNNG 9 cut(s) 29, 44, 65, 77, 84, 94, 100, 131, 164
Sse9I AATT 1 cut(s) 27
SsiI CCGC 1 cut(s) 68
TaaI ACNGT 2 cut(s) 56, 126
TaqI TCGA 1 cut(s) 38
TasI AATT 1 cut(s) 27
TauI GCSGC 1 cut(s) 71
XcmI CCANNNNNNNNNTGG 1 cut(s) 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.