RchiOBHm_Chr7g0221431

Belongs to the chalcone isomerase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
42476475 .. 42477144
670 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19814

Sequence Viewer

Length: 324 bp
ATGCAGAAGCCAAAGCCATTGAAAAGTTTATGGAGGTCTTCAAAGATCAGACCTTCCCACCTGGTGCTTCTATTCTCCACACAATCACCAAATGGATCATTGACGATTGGCTTCTCCAAAGATGGTTCCATACCAGCAGTTGGAAATGCGGTGATTGAAAACAAGCTACTTTCAGAGTCAGTTCTCGAGTCAATCATTGGAAAGCAAGGTGTTTCTCCTGAAGCAAGGAAATGTGTGGCTACAAGGCTATCAGAATTGTTGAAAGAGAGTGATGATTGCGTGGCCGGAAATGGGGAAGTAAAGGAAGCAGAAGTTAAGGCATGA

Protein Analysis

107

Amino Acids

11.43

Weight (kDa)

9.0

Isoelectric Point (pI)

40.0

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Chalcone PF02431 11 - 86 2.8e-24 Chalcone-flavanone isomerase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 140
AciI CCGC 1 cut(s) 149
AclWI GGATC 1 cut(s) 103
AcoI YGGCCR 1 cut(s) 282
AcuI CTGAAG 1 cut(s) 240
AdeI CACNNNGTG 1 cut(s) 64
AfiI CCNNNNNNNGG 2 cut(s) 140, 291
AgsI TTSAA 4 cut(s) 22, 42, 158, 262
AjnI CCWGG 1 cut(s) 60
AluBI AGCT 1 cut(s) 166
AluI AGCT 1 cut(s) 166
AlwI GGATC 1 cut(s) 103
Ama87I CYCGRG 1 cut(s) 185
AoxI GGCC 1 cut(s) 282
AsuHPI GGTGA 2 cut(s) 78, 163
AvaI CYCGRG 1 cut(s) 185
BbsI GAAGAC 1 cut(s) 30
BccI CCATC 1 cut(s) 116
BciT130I CCWGG 1 cut(s) 62
Bme1390I CCNGG 1 cut(s) 62
BmeT110I CYCGRG 1 cut(s) 185
BmiI GGNNCC 1 cut(s) 127
BmrFI CCNGG 1 cut(s) 62
BpiI GAAGAC 1 cut(s) 30
Bsc4I CCNNNNNNNGG 2 cut(s) 140, 291
BseBI CCWGG 1 cut(s) 62
BseLI CCNNNNNNNGG 2 cut(s) 140, 291
BshFI GGCC 1 cut(s) 284
BsiHKCI CYCGRG 1 cut(s) 185
BsiSI CCGG 1 cut(s) 285
BslI CCNNNNNNNGG 2 cut(s) 140, 291
BsnI GGCC 1 cut(s) 284
BsoBI CYCGRG 1 cut(s) 185
Bsp143I GATC 2 cut(s) 45, 95
BspACI CCGC 1 cut(s) 149
BspANI GGCC 1 cut(s) 284
BspLI GGNNCC 1 cut(s) 127
BspPI GGATC 1 cut(s) 103
BssMI GATC 2 cut(s) 45, 95
Bst2UI CCWGG 1 cut(s) 62
BstKTI GATC 2 cut(s) 48, 98
BstMBI GATC 2 cut(s) 45, 95
BstNI CCWGG 1 cut(s) 62
BstSCI CCNGG 1 cut(s) 60
BstV2I GAAGAC 1 cut(s) 30
BsuRI GGCC 1 cut(s) 284
CsiI ACCWGGT 1 cut(s) 60
CviAII CATG 1 cut(s) 321
CviJI RGCY 7 cut(s) 10, 16, 111, 166, 239, 247, 284
CviKI_1 RGCY 7 cut(s) 10, 16, 111, 166, 239, 247, 284
DpnI GATC 2 cut(s) 47, 97
DpnII GATC 2 cut(s) 45, 95
DraIII CACNNNGTG 1 cut(s) 64
EaeI YGGCCR 1 cut(s) 282
Eco57I CTGAAG 1 cut(s) 240
Eco88I CYCGRG 1 cut(s) 185
EcoRII CCWGG 1 cut(s) 60
FaeI CATG 1 cut(s) 324
FaiI YATR 3 cut(s) 31, 131, 322
FatI CATG 1 cut(s) 320
HaeIII GGCC 1 cut(s) 284
HapII CCGG 1 cut(s) 285
Hin1II CATG 1 cut(s) 324
HinfI GANTC 2 cut(s) 176, 188
HpaII CCGG 1 cut(s) 285
HphI GGTGA 2 cut(s) 78, 163
Hpy188I TCNGA 3 cut(s) 50, 175, 253
Hpy188III TCNNGA 2 cut(s) 185, 218
HpyAV CCTTC 1 cut(s) 63
HpyCH4V TGCA 1 cut(s) 4
Hsp92II CATG 1 cut(s) 324
Kzo9I GATC 2 cut(s) 45, 95
LpnPI CCDG 5 cut(s) 47, 74, 147, 231, 298
MabI ACCWGGT 1 cut(s) 60
MalI GATC 2 cut(s) 47, 97
MboI GATC 2 cut(s) 45, 95
MboII GAAGA 1 cut(s) 30
MluCI AATT 1 cut(s) 254
MlyI GAGTC 2 cut(s) 185, 197
MmeI TCCRAC 1 cut(s) 121
MnlI CCTC 1 cut(s) 27
MseI TTAA 1 cut(s) 315
MspI CCGG 1 cut(s) 285
MspR9I CCNGG 1 cut(s) 62
MvaI CCWGG 1 cut(s) 62
NdeII GATC 2 cut(s) 45, 95
NlaIII CATG 1 cut(s) 324
NlaIV GGNNCC 1 cut(s) 127
PaeR7I CTCGAG 1 cut(s) 185
PflMI CCANNNNNTGG 1 cut(s) 140
PleI GAGTC 2 cut(s) 184, 196
PpsI GAGTC 2 cut(s) 184, 196
Psp6I CCWGG 1 cut(s) 60
PspGI CCWGG 1 cut(s) 60
PspN4I GGNNCC 1 cut(s) 127
SaqAI TTAA 1 cut(s) 315
Sau3AI GATC 2 cut(s) 45, 95
SchI GAGTC 2 cut(s) 185, 197
ScrFI CCNGG 1 cut(s) 62
SetI ASST 5 cut(s) 38, 55, 63, 168, 211
SexAI ACCWGGT 1 cut(s) 60
Sfr274I CTCGAG 1 cut(s) 185
SlaI CTCGAG 1 cut(s) 185
SmlI CTYRAG 1 cut(s) 185
SmoI CTYRAG 1 cut(s) 185
Sse9I AATT 1 cut(s) 254
SsiI CCGC 1 cut(s) 149
StyD4I CCNGG 1 cut(s) 60
TaqI TCGA 1 cut(s) 186
TasI AATT 1 cut(s) 254
Tru1I TTAA 1 cut(s) 315
Tru9I TTAA 1 cut(s) 315
Van91I CCANNNNNTGG 1 cut(s) 140
XhoI CTCGAG 1 cut(s) 185
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.