pycom09g03010

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
OG0002081
Physical Location & Seq
Forward (+)
2226174 .. 2226359
186 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom09g03010.1

Sequence Viewer

Length: 186 bp
ATGGGGAAGCCATCCAAAGGCAAGAAATCTGAGAATTTGGGAAAGGGAATGGTCACCCCCATCCAAATTGTCTTCATCGTCGACCGATACCTCTGTGACAACAACTACTTGGTAACCCGCTCTCTTTTCAGAACCGAAGCTTCGTCCCTCATCGCCAAATCGCCAATTCGAGAGGTACCCACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.8

Weight (kDa)

9.8

Isoelectric Point (pI)

24.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 175
AccB1I GGYRCC 1 cut(s) 175
AccBSI CCGCTC 1 cut(s) 120
AccI GTMKAC 1 cut(s) 81
AciI CCGC 1 cut(s) 118
AcsI RAATTY 1 cut(s) 34
AfaI GTAC 1 cut(s) 177
AfiI CCNNNNNNNGG 1 cut(s) 17
AluBI AGCT 1 cut(s) 140
AluI AGCT 1 cut(s) 140
ApoI RAATTY 1 cut(s) 34
Asp718I GGTACC 1 cut(s) 175
AsuHPI GGTGA 1 cut(s) 46
BaeI ACNNNNGTAYC 2 cut(s) 79, 112
BanI GGYRCC 1 cut(s) 175
BbsI GAAGAC 1 cut(s) 64
BccI CCATC 2 cut(s) 19, 68
BmiI GGNNCC 1 cut(s) 177
BpiI GAAGAC 1 cut(s) 64
Bsc4I CCNNNNNNNGG 1 cut(s) 17
BseGI GGATG 2 cut(s) 11, 60
BseLI CCNNNNNNNGG 1 cut(s) 17
BseMII CTCAG 1 cut(s) 21
Bsh1285I CGRYCG 1 cut(s) 85
BshNI GGYRCC 1 cut(s) 175
BsiEI CGRYCG 1 cut(s) 85
BslFI GGGAC 1 cut(s) 130
BslI CCNNNNNNNGG 1 cut(s) 17
BsmFI GGGAC 1 cut(s) 130
BspACI CCGC 1 cut(s) 118
BspCNI CTCAG 1 cut(s) 22
BspLI GGNNCC 1 cut(s) 177
BspT107I GGYRCC 1 cut(s) 175
BsrBI CCGCTC 1 cut(s) 120
BstDEI CTNAG 1 cut(s) 30
BstEII GGTNACC 2 cut(s) 52, 112
BstF5I GGATG 2 cut(s) 11, 60
BstMCI CGRYCG 1 cut(s) 85
BstPI GGTNACC 2 cut(s) 52, 112
BstV2I GAAGAC 1 cut(s) 64
BtgZI GCGATG 1 cut(s) 136
BtsCI GGATG 2 cut(s) 11, 60
Csp6I GTAC 1 cut(s) 176
CviJI RGCY 2 cut(s) 10, 140
CviKI_1 RGCY 2 cut(s) 10, 140
CviQI GTAC 1 cut(s) 176
DdeI CTNAG 1 cut(s) 30
Eco91I GGTNACC 2 cut(s) 52, 112
EcoO65I GGTNACC 2 cut(s) 52, 112
FaqI GGGAC 1 cut(s) 130
FauI CCCGC 1 cut(s) 125
FblI GTMKAC 1 cut(s) 81
FokI GGATG 1 cut(s) 47
HincII GTYRAC 1 cut(s) 82
HindII GTYRAC 1 cut(s) 82
HindIII AAGCTT 1 cut(s) 138
HphI GGTGA 1 cut(s) 46
Hpy166II GTNNAC 1 cut(s) 82
Hpy188I TCNGA 2 cut(s) 31, 131
Hpy188III TCNNGA 1 cut(s) 170
Hpy8I GTNNAC 1 cut(s) 82
Hpy99I CGWCG 1 cut(s) 83
HpyF3I CTNAG 1 cut(s) 30
KpnI GGTACC 1 cut(s) 179
MaeIII GTNAC 3 cut(s) 52, 95, 112
MbiI CCGCTC 1 cut(s) 120
MboII GAAGA 1 cut(s) 64
MluCI AATT 3 cut(s) 34, 66, 165
MnlI CCTC 3 cut(s) 101, 158, 166
NlaIV GGNNCC 1 cut(s) 177
NmuCI GTSAC 2 cut(s) 52, 95
PspEI GGTNACC 2 cut(s) 52, 112
PspN4I GGNNCC 1 cut(s) 177
RsaI GTAC 1 cut(s) 177
RsaNI GTAC 1 cut(s) 176
SalI GTCGAC 1 cut(s) 80
SetI ASST 3 cut(s) 93, 142, 177
SgeI CNNG 4 cut(s) 34, 121, 129, 182
Sse9I AATT 3 cut(s) 34, 66, 165
SsiI CCGC 1 cut(s) 118
TaqI TCGA 2 cut(s) 81, 169
TaqII GACCGA 1 cut(s) 99
TasI AATT 3 cut(s) 34, 66, 165
TseFI GTSAC 2 cut(s) 52, 95
Tsp45I GTSAC 2 cut(s) 52, 95
TspDTI ATGAA 1 cut(s) 64
XapI RAATTY 1 cut(s) 34
XmiI GTMKAC 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.