Rh7CG209500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
OG0002081
Physical Location & Seq
Forward (+)
18763021 .. 18763582
562 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG209500.1

Sequence Viewer

Length: 366 bp
ATGGCGAAGCAATCTGAAGCCAGAAATCAGAGAATCTGGGCCAGGGCACCTCATCCAAATCGTCTTTCTTGTCAACCAGTGTCAAAGAGCTTGCTGAGTTTGTCTGAGATTCTGATCAAGTACATAGCATTGAAGGAGCAGAAAGTGTTGGACCATGAGAAGGTTCAGGTGGAGCAAGAGAAGACCAGGGTTCAGAAGTTGTTGAATGGGTTGCAGAACTCGATAAACGTTTACAATGCCAGTGGAAACCCCCAAATCTCCAAAGTTTCGGATGTGGCACCGAAACAAATACACATGGCTCCTCAGTCTCGCCTATCTAATGGGTCTTCTACAGGTACAATCCTAACCCCATTTTCTTGTATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

121

Amino Acids

13.46

Weight (kDa)

9.88

Isoelectric Point (pI)

48.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 46, 277
AclI AACGTT 1 cut(s) 228
AcuI CTGAAG 1 cut(s) 36
AfaI GTAC 2 cut(s) 122, 337
AfiI CCNNNNNNNGG 1 cut(s) 160
AgsI TTSAA 2 cut(s) 133, 205
AjnI CCWGG 2 cut(s) 41, 185
AjuI GAANNNNNNNTTGG 2 cut(s) 49, 81
AluBI AGCT 1 cut(s) 90
AluI AGCT 1 cut(s) 90
Alw26I GTCTC 1 cut(s) 312
AoxI GGCC 1 cut(s) 39
AspS9I GGNCC 2 cut(s) 39, 151
AvaII GGWCC 1 cut(s) 151
BaeGI GKGCMC 1 cut(s) 49
BanI GGYRCC 2 cut(s) 46, 277
BbsI GAAGAC 2 cut(s) 188, 318
BciT130I CCWGG 2 cut(s) 43, 187
BclI TGATCA 1 cut(s) 114
BcoDI GTCTC 1 cut(s) 312
BfmI CTRYAG 1 cut(s) 330
Bme1390I CCNGG 2 cut(s) 43, 187
Bme18I GGWCC 1 cut(s) 151
BmgT120I GGNCC 2 cut(s) 39, 151
BmiI GGNNCC 3 cut(s) 48, 279, 300
BmrFI CCNGG 2 cut(s) 43, 187
BpiI GAAGAC 2 cut(s) 188, 318
BsaBI GATNNNNATC 1 cut(s) 113
BsaJI CCNNGG 2 cut(s) 42, 186
Bsc4I CCNNNNNNNGG 1 cut(s) 160
Bse1I ACTGG 2 cut(s) 77, 240
Bse8I GATNNNNATC 1 cut(s) 113
BseBI CCWGG 2 cut(s) 43, 187
BseDI CCNNGG 2 cut(s) 42, 186
BseGI GGATG 2 cut(s) 52, 277
BseJI GATNNNNATC 1 cut(s) 113
BseLI CCNNNNNNNGG 1 cut(s) 160
BseMII CTCAG 3 cut(s) 86, 96, 317
BseNI ACTGG 2 cut(s) 77, 240
BseRI GAGGAG 1 cut(s) 291
BseSI GKGCMC 1 cut(s) 49
BshFI GGCC 1 cut(s) 41
BshNI GGYRCC 2 cut(s) 46, 277
BslI CCNNNNNNNGG 1 cut(s) 160
BsmAI GTCTC 1 cut(s) 312
BsnI GGCC 1 cut(s) 41
Bsp1286I GDGCHC 1 cut(s) 49
Bsp143I GATC 1 cut(s) 114
BspANI GGCC 1 cut(s) 41
BspCNI CTCAG 3 cut(s) 87, 97, 316
BspLI GGNNCC 3 cut(s) 48, 279, 300
BspT107I GGYRCC 2 cut(s) 46, 277
BsrI ACTGG 2 cut(s) 77, 240
BssECI CCNNGG 2 cut(s) 42, 186
BssMI GATC 1 cut(s) 114
Bst2UI CCWGG 2 cut(s) 43, 187
BstC8I GCNNGC 1 cut(s) 92
BstDEI CTNAG 3 cut(s) 95, 105, 303
BstF5I GGATG 2 cut(s) 52, 277
BstKTI GATC 1 cut(s) 117
BstMAI GTCTC 1 cut(s) 312
BstMBI GATC 1 cut(s) 114
BstNI CCWGG 2 cut(s) 43, 187
BstSCI CCNGG 2 cut(s) 41, 185
BstSFI CTRYAG 1 cut(s) 330
BstSLI GKGCMC 1 cut(s) 49
BstV2I GAAGAC 2 cut(s) 188, 318
BsuRI GGCC 1 cut(s) 41
BtsCI GGATG 2 cut(s) 52, 277
BtsIMutI CAGTG 2 cut(s) 84, 247
Cac8I GCNNGC 1 cut(s) 92
Cfr13I GGNCC 2 cut(s) 39, 151
Csp6I GTAC 2 cut(s) 121, 336
CspCI CAANNNNNGTGG 2 cut(s) 223, 258
CviAII CATG 2 cut(s) 155, 295
CviJI RGCY 4 cut(s) 20, 41, 90, 299
CviKI_1 RGCY 4 cut(s) 20, 41, 90, 299
CviQI GTAC 2 cut(s) 121, 336
DdeI CTNAG 3 cut(s) 95, 105, 303
DpnI GATC 1 cut(s) 116
DpnII GATC 1 cut(s) 114
Eco47I GGWCC 1 cut(s) 151
Eco57I CTGAAG 1 cut(s) 36
EcoRII CCWGG 2 cut(s) 41, 185
FaeI CATG 2 cut(s) 158, 298
FaiI YATR 3 cut(s) 125, 156, 296
FatI CATG 2 cut(s) 154, 294
FbaI TGATCA 1 cut(s) 114
FokI GGATG 2 cut(s) 39, 284
HaeIII GGCC 1 cut(s) 41
Hin1II CATG 2 cut(s) 158, 298
HincII GTYRAC 1 cut(s) 74
HindII GTYRAC 1 cut(s) 74
HinfI GANTC 2 cut(s) 33, 109
Hpy166II GTNNAC 2 cut(s) 74, 232
Hpy188I TCNGA 6 cut(s) 16, 30, 106, 114, 195, 271
Hpy8I GTNNAC 2 cut(s) 74, 232
HpyAV CCTTC 2 cut(s) 127, 154
HpyCH4IV ACGT 1 cut(s) 228
HpyCH4V TGCA 1 cut(s) 214
HpyF3I CTNAG 3 cut(s) 95, 105, 303
HpySE526I ACGT 1 cut(s) 228
Hsp92II CATG 2 cut(s) 158, 298
Ksp22I TGATCA 1 cut(s) 114
Kzo9I GATC 1 cut(s) 114
LmnI GCTCC 3 cut(s) 136, 172, 304
MaeII ACGT 1 cut(s) 228
MalI GATC 1 cut(s) 116
MboI GATC 1 cut(s) 114
MboII GAAGA 2 cut(s) 193, 318
MhlI GDGCHC 1 cut(s) 49
MmeI TCCRAC 1 cut(s) 129
MnlI CCTC 2 cut(s) 60, 312
MspR9I CCNGG 2 cut(s) 43, 187
MvaI CCWGG 2 cut(s) 43, 187
NdeII GATC 1 cut(s) 114
NlaIII CATG 2 cut(s) 158, 298
NlaIV GGNNCC 3 cut(s) 48, 279, 300
PfeI GAWTC 2 cut(s) 33, 109
Psp1406I AACGTT 1 cut(s) 228
Psp6I CCWGG 2 cut(s) 41, 185
PspGI CCWGG 2 cut(s) 41, 185
PspN4I GGNNCC 3 cut(s) 48, 279, 300
PspPI GGNCC 2 cut(s) 39, 151
RsaI GTAC 2 cut(s) 122, 337
RsaNI GTAC 2 cut(s) 121, 336
Sau3AI GATC 1 cut(s) 114
Sau96I GGNCC 2 cut(s) 39, 151
ScrFI CCNGG 2 cut(s) 43, 187
SduI GDGCHC 1 cut(s) 49
SetI ASST 6 cut(s) 52, 92, 165, 171, 231, 337
SfcI CTRYAG 1 cut(s) 330
SinI GGWCC 1 cut(s) 151
StyD4I CCNGG 2 cut(s) 41, 185
TaiI ACGT 1 cut(s) 231
TaqI TCGA 1 cut(s) 221
TatI WGTACW 1 cut(s) 120
TfiI GAWTC 2 cut(s) 33, 109
TscAI CASTG 2 cut(s) 84, 247
TspRI CASTG 2 cut(s) 84, 247
VpaK11BI GGWCC 1 cut(s) 151
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.