pycom09g11110

FLX-like 3

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
OG0003143
Physical Location & Seq
Forward (+)
9255677 .. 9256832
1156 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom09g11110.1

Sequence Viewer

Length: 396 bp
ATGAGAAAAGTAGGAAATTGGAAATTGGAGGCTGATCTACGGGCAACTGAGCCCTTCAAAAATGAGGCTAAGCAACTTCGCTCTGAAGTTCAGAAGCTGACTAGTGTTAGGAAGGAACTTACCACACAAGTTCAGACCCTCACGCAGGACCTTGCGAGGTTGCAGTCCAACAATGAGCAGATTCCTATGCTAAGGACTGAGATTGATGGTCTGCATCAGGAGCTTATGCATGCCAGACATGCAATCGATTATGAAAAGAAGGCAAATATTGAGCTTATGAAGCAAAGACAGGCAATGGAGAAGAACCTAGTTTCTATGGCACATGAAGTTGAGAAACTACGTGCAGAACTTTCTAGGGCTGATGGTAGACCATGGGGTGTGGACAAGATGGTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

132

Amino Acids

15.28

Weight (kDa)

9.26

Isoelectric Point (pI)

47.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF4686 PF15742 19 - 119 4.2e-06 Domain of unknown function (DUF4686)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 367
AcuI CTGAAG 1 cut(s) 105
AfiI CCNNNNNNNGG 1 cut(s) 145
AgsI TTSAA 1 cut(s) 58
AhlI ACTAGT 1 cut(s) 101
AluBI AGCT 3 cut(s) 97, 223, 274
AluI AGCT 3 cut(s) 97, 223, 274
AlwNI CAGNNNCTG 1 cut(s) 97
AspS9I GGNCC 1 cut(s) 148
AvaII GGWCC 1 cut(s) 148
BanII GRGCYC 1 cut(s) 54
BccI CCATC 3 cut(s) 200, 356, 382
BcuI ACTAGT 1 cut(s) 101
BfaI CTAG 3 cut(s) 102, 308, 354
BlpI GCTNAGC 1 cut(s) 69
Bme18I GGWCC 1 cut(s) 148
BmgT120I GGNCC 1 cut(s) 148
BmsI GCATC 1 cut(s) 223
Bpu10I CCTNAGC 1 cut(s) 191
Bpu1102I GCTNAGC 1 cut(s) 69
Bsa29I ATCGAT 1 cut(s) 246
BsaAI YACGTR 1 cut(s) 341
BsaJI CCNNGG 1 cut(s) 371
Bsc4I CCNNNNNNNGG 1 cut(s) 145
Bse3DI GCAATG 1 cut(s) 300
BseCI ATCGAT 1 cut(s) 246
BseDI CCNNGG 1 cut(s) 371
BseLI CCNNNNNNNGG 1 cut(s) 145
BseMI GCAATG 1 cut(s) 300
BseMII CTCAG 2 cut(s) 39, 189
BsgI GTGCAG 1 cut(s) 363
BshVI ATCGAT 1 cut(s) 246
BslI CCNNNNNNNGG 1 cut(s) 145
Bsp1286I GDGCHC 1 cut(s) 54
Bsp143I GATC 1 cut(s) 34
Bsp1720I GCTNAGC 1 cut(s) 69
Bsp19I CCATGG 1 cut(s) 371
BspCNI CTCAG 2 cut(s) 40, 190
BspDI ATCGAT 1 cut(s) 246
BsrDI GCAATG 1 cut(s) 300
BssECI CCNNGG 1 cut(s) 371
BssMI GATC 1 cut(s) 34
BssT1I CCWWGG 1 cut(s) 371
BstBAI YACGTR 1 cut(s) 341
BstC8I GCNNGC 1 cut(s) 231
BstDEI CTNAG 4 cut(s) 48, 69, 191, 198
BstDSI CCRYGG 1 cut(s) 371
BstENI CCTNNNNNAGG 1 cut(s) 143
BstKTI GATC 1 cut(s) 37
BstMBI GATC 1 cut(s) 34
BstMWI GCNNNNNNNGC 3 cut(s) 220, 239, 280
BstNSI RCATGY 2 cut(s) 233, 242
Bsu15I ATCGAT 1 cut(s) 246
BsuTUI ATCGAT 1 cut(s) 246
BtgI CCRYGG 1 cut(s) 371
Cac8I GCNNGC 1 cut(s) 231
CaiI CAGNNNCTG 1 cut(s) 97
Cfr13I GGNCC 1 cut(s) 148
ClaI ATCGAT 1 cut(s) 246
CviAII CATG 4 cut(s) 230, 239, 323, 372
CviJI RGCY 7 cut(s) 32, 52, 68, 97, 223, 274, 359
CviKI_1 RGCY 7 cut(s) 32, 52, 68, 97, 223, 274, 359
DdeI CTNAG 4 cut(s) 48, 69, 191, 198
DpnI GATC 1 cut(s) 36
DpnII GATC 1 cut(s) 34
Eco130I CCWWGG 1 cut(s) 371
Eco24I GRGCYC 1 cut(s) 54
Eco47I GGWCC 1 cut(s) 148
Eco57I CTGAAG 1 cut(s) 105
EcoNI CCTNNNNNAGG 1 cut(s) 143
EcoO109I RGGNCCY 1 cut(s) 148
EcoT14I CCWWGG 1 cut(s) 371
EcoT22I ATGCAT 1 cut(s) 231
EcoT38I GRGCYC 1 cut(s) 54
ErhI CCWWGG 1 cut(s) 371
FaeI CATG 4 cut(s) 233, 242, 326, 375
FatI CATG 4 cut(s) 229, 238, 322, 371
FblI GTMKAC 1 cut(s) 367
FriOI GRGCYC 1 cut(s) 54
FspBI CTAG 3 cut(s) 102, 308, 354
Hin1II CATG 4 cut(s) 233, 242, 326, 375
HinfI GANTC 1 cut(s) 181
Hpy166II GTNNAC 2 cut(s) 368, 382
Hpy188I TCNGA 3 cut(s) 85, 93, 135
Hpy188III TCNNGA 1 cut(s) 218
Hpy8I GTNNAC 2 cut(s) 368, 382
HpyAV CCTTC 3 cut(s) 64, 106, 253
HpyCH4IV ACGT 1 cut(s) 340
HpyCH4V TGCA 5 cut(s) 163, 214, 229, 242, 344
HpyF10VI GCNNNNNNNGC 3 cut(s) 220, 239, 280
HpyF3I CTNAG 4 cut(s) 48, 69, 191, 198
HpySE526I ACGT 1 cut(s) 340
Hsp92II CATG 4 cut(s) 233, 242, 326, 375
Kzo9I GATC 1 cut(s) 34
LmnI GCTCC 1 cut(s) 220
LpnPI CCDG 4 cut(s) 131, 203, 247, 275
LweI GCATC 1 cut(s) 223
MaeI CTAG 3 cut(s) 102, 308, 354
MaeII ACGT 1 cut(s) 340
MalI GATC 1 cut(s) 36
MboI GATC 1 cut(s) 34
MboII GAAGA 1 cut(s) 313
MhlI GDGCHC 1 cut(s) 54
MluCI AATT 2 cut(s) 16, 23
MmeI TCCRAC 1 cut(s) 192
MnlI CCTC 4 cut(s) 22, 58, 149, 150
Mph1103I ATGCAT 1 cut(s) 231
MwoI GCNNNNNNNGC 3 cut(s) 220, 239, 280
NcoI CCATGG 1 cut(s) 371
NdeII GATC 1 cut(s) 34
NlaIII CATG 4 cut(s) 233, 242, 326, 375
NsiI ATGCAT 1 cut(s) 231
NspI RCATGY 2 cut(s) 233, 242
PaeI GCATGC 1 cut(s) 233
PfeI GAWTC 1 cut(s) 181
Ppu21I YACGTR 1 cut(s) 341
PpuMI RGGWCCY 1 cut(s) 148
Psp5II RGGWCCY 1 cut(s) 148
PspPI GGNCC 1 cut(s) 148
PspPPI RGGWCCY 1 cut(s) 148
PstNI CAGNNNCTG 1 cut(s) 97
Sau3AI GATC 1 cut(s) 34
Sau96I GGNCC 1 cut(s) 148
SduI GDGCHC 1 cut(s) 54
SetI ASST 7 cut(s) 99, 153, 161, 225, 276, 309, 343
SfaNI GCATC 1 cut(s) 223
SinI GGWCC 1 cut(s) 148
SpeI ACTAGT 1 cut(s) 101
SphI GCATGC 1 cut(s) 233
Sse9I AATT 2 cut(s) 16, 23
SspI AATATT 1 cut(s) 268
SspMI CTAG 3 cut(s) 102, 308, 354
StyI CCWWGG 1 cut(s) 371
TaiI ACGT 1 cut(s) 343
TaqI TCGA 1 cut(s) 246
TasI AATT 2 cut(s) 16, 23
TfiI GAWTC 1 cut(s) 181
TspDTI ATGAA 3 cut(s) 267, 293, 339
VpaK11BI GGWCC 1 cut(s) 148
XagI CCTNNNNNAGG 1 cut(s) 143
XceI RCATGY 2 cut(s) 233, 242
XmiI GTMKAC 1 cut(s) 367
XspI CTAG 3 cut(s) 102, 308, 354
Zsp2I ATGCAT 1 cut(s) 231
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.