Rroxscaffold_7G00201140

FLX-like 3

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
48610695 .. 48612510
1816 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00201140.1

Sequence Viewer

Length: 246 bp
ATGGTGATAGTGAAGATTCCTTTGTTAAAGTCTGAGATTGATGGTCTGCACCAGGAGCTTATGCATGCTAGAAGTGCAATTGATTATGAAAAGAAGGCAAATATTGAGCTTATGGAACAGAGACAGGCAATGGAGAATAACCTAGTTTCTATGGCTCGTGAAGTTGAGAAACTTCGTGCAGAACTTGCTAGAGTTGATGGTAGACCGTGGGGTGCAGTTTTTGGTTGGCAAAAAAGCTCGTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

9.35

Weight (kDa)

6.73

Isoelectric Point (pI)

44.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 202
AfaI GTAC 1 cut(s) 242
AjnI CCWGG 1 cut(s) 51
AluBI AGCT 3 cut(s) 58, 109, 237
AluI AGCT 3 cut(s) 58, 109, 237
Alw26I GTCTC 1 cut(s) 115
AsuHPI GGTGA 1 cut(s) 16
BauI CACGAG 1 cut(s) 156
BccI CCATC 2 cut(s) 35, 191
BciT130I CCWGG 1 cut(s) 53
BcoDI GTCTC 1 cut(s) 115
BfaI CTAG 4 cut(s) 69, 143, 189, 244
Bme1390I CCNGG 1 cut(s) 53
BmrFI CCNGG 1 cut(s) 53
BsaJI CCNNGG 1 cut(s) 206
Bse3DI GCAATG 1 cut(s) 135
BseBI CCWGG 1 cut(s) 53
BseDI CCNNGG 1 cut(s) 206
BseMI GCAATG 1 cut(s) 135
BseMII CTCAG 1 cut(s) 24
BsgI GTGCAG 3 cut(s) 32, 198, 234
BsmAI GTCTC 1 cut(s) 115
BspCNI CTCAG 1 cut(s) 25
BsrDI GCAATG 1 cut(s) 135
BssECI CCNNGG 1 cut(s) 206
BssSI CACGAG 1 cut(s) 156
Bst2BI CACGAG 1 cut(s) 156
Bst2UI CCWGG 1 cut(s) 53
Bst4CI ACNGT 1 cut(s) 207
BstAPI GCANNNNNTGC 1 cut(s) 185
BstC8I GCNNGC 1 cut(s) 66
BstDEI CTNAG 1 cut(s) 33
BstDSI CCRYGG 1 cut(s) 206
BstMAI GTCTC 1 cut(s) 115
BstMWI GCNNNNNNNGC 3 cut(s) 55, 74, 185
BstNI CCWGG 1 cut(s) 53
BstNSI RCATGY 1 cut(s) 68
BstSCI CCNGG 1 cut(s) 51
BtgI CCRYGG 1 cut(s) 206
Cac8I GCNNGC 1 cut(s) 66
Csp6I GTAC 1 cut(s) 241
CviAII CATG 1 cut(s) 65
CviJI RGCY 4 cut(s) 58, 109, 155, 237
CviKI_1 RGCY 4 cut(s) 58, 109, 155, 237
CviQI GTAC 1 cut(s) 241
DdeI CTNAG 1 cut(s) 33
EcoRII CCWGG 1 cut(s) 51
EcoT22I ATGCAT 1 cut(s) 66
FaeI CATG 1 cut(s) 68
FaiI YATR 5 cut(s) 62, 66, 87, 113, 152
FatI CATG 1 cut(s) 64
FblI GTMKAC 1 cut(s) 202
FspBI CTAG 4 cut(s) 69, 143, 189, 244
Hin1II CATG 1 cut(s) 68
HinfI GANTC 1 cut(s) 16
HphI GGTGA 1 cut(s) 16
Hpy166II GTNNAC 1 cut(s) 203
Hpy188I TCNGA 1 cut(s) 34
Hpy188III TCNNGA 1 cut(s) 158
Hpy8I GTNNAC 1 cut(s) 203
HpyAV CCTTC 1 cut(s) 88
HpyCH4III ACNGT 1 cut(s) 207
HpyCH4V TGCA 5 cut(s) 49, 64, 77, 179, 215
HpyF10VI GCNNNNNNNGC 3 cut(s) 55, 74, 185
HpyF3I CTNAG 1 cut(s) 33
Hsp92II CATG 1 cut(s) 68
LmnI GCTCC 1 cut(s) 55
LpnPI CCDG 3 cut(s) 38, 65, 110
MaeI CTAG 4 cut(s) 69, 143, 189, 244
MboII GAAGA 1 cut(s) 25
MfeI CAATTG 1 cut(s) 78
MluCI AATT 1 cut(s) 78
Mph1103I ATGCAT 1 cut(s) 66
MseI TTAA 1 cut(s) 26
MspR9I CCNGG 1 cut(s) 53
MunI CAATTG 1 cut(s) 78
MvaI CCWGG 1 cut(s) 53
MwoI GCNNNNNNNGC 3 cut(s) 55, 74, 185
NlaIII CATG 1 cut(s) 68
NsiI ATGCAT 1 cut(s) 66
NspI RCATGY 1 cut(s) 68
PaeI GCATGC 1 cut(s) 68
PfeI GAWTC 1 cut(s) 16
Psp6I CCWGG 1 cut(s) 51
PspGI CCWGG 1 cut(s) 51
RsaI GTAC 1 cut(s) 242
RsaNI GTAC 1 cut(s) 241
SaqAI TTAA 1 cut(s) 26
ScrFI CCNGG 1 cut(s) 53
SetI ASST 4 cut(s) 60, 111, 144, 239
SphI GCATGC 1 cut(s) 68
Sse9I AATT 1 cut(s) 78
SspI AATATT 1 cut(s) 103
SspMI CTAG 4 cut(s) 69, 143, 189, 244
StyD4I CCNGG 1 cut(s) 51
TaaI ACNGT 1 cut(s) 207
TasI AATT 1 cut(s) 78
TfiI GAWTC 1 cut(s) 16
Tru1I TTAA 1 cut(s) 26
Tru9I TTAA 1 cut(s) 26
TspDTI ATGAA 1 cut(s) 102
XceI RCATGY 1 cut(s) 68
XmiI GTMKAC 1 cut(s) 202
XspI CTAG 4 cut(s) 69, 143, 189, 244
Zsp2I ATGCAT 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.