Rh3CG305700

FLX-like 3

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
OG0003143
Physical Location & Seq
Forward (+)
31901306 .. 31902539
1234 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG305700.1

Sequence Viewer

Length: 354 bp
ATGTGTAATATTATGGTTCTTTATGCTTTGGTTTTTAGCTATCAACAGATTCCTTTGCTAAAGTCTGAGATTGATGGTCTGCACCAGGAGCTTATGCATACTAGGAGTGCAATTGATTATGAAAAGAAGGCAAATATTGAGCTTATGGAACAGAGACAGGCAATGGAGAATAACCTAGTTTCTATGGCTCGTGAAGTTGAGAAACTTCATGCAGAACTTGCTAGAGTTGATGGTAGACCGTGCGGTGCAGATGCTCGCGAAGTCCGTCAACCTCAGAGACCTAAACCCATGCAATCTGCAGGGAGTGATCTCTTGACCAGGGAAGCATATAATTTGAGTATTCCAACTCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

117

Amino Acids

13.38

Weight (kDa)

6.07

Isoelectric Point (pI)

46.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 235
AccII CGCG 1 cut(s) 258
AciI CCGC 1 cut(s) 243
AjnI CCWGG 2 cut(s) 84, 317
AluBI AGCT 3 cut(s) 39, 91, 142
AluI AGCT 3 cut(s) 39, 91, 142
Alw26I GTCTC 2 cut(s) 148, 271
BauI CACGAG 1 cut(s) 189
BccI CCATC 2 cut(s) 68, 224
BciT130I CCWGG 2 cut(s) 86, 319
BcoDI GTCTC 2 cut(s) 148, 271
BfaI CTAG 3 cut(s) 102, 176, 222
BfmI CTRYAG 1 cut(s) 297
Bme1390I CCNGG 2 cut(s) 86, 319
BmrFI CCNGG 2 cut(s) 86, 319
BmsI GCATC 1 cut(s) 241
BsaI GGTCTC 1 cut(s) 271
BsaJI CCNNGG 1 cut(s) 318
Bse3DI GCAATG 1 cut(s) 168
BseBI CCWGG 2 cut(s) 86, 319
BseDI CCNNGG 1 cut(s) 318
BseMI GCAATG 1 cut(s) 168
BseMII CTCAG 2 cut(s) 57, 287
BsgI GTGCAG 2 cut(s) 65, 267
Bsh1236I CGCG 1 cut(s) 258
BsmAI GTCTC 2 cut(s) 148, 271
Bso31I GGTCTC 1 cut(s) 271
Bsp143I GATC 1 cut(s) 307
Bsp68I TCGCGA 1 cut(s) 258
BspACI CCGC 1 cut(s) 243
BspCNI CTCAG 2 cut(s) 58, 286
BspFNI CGCG 1 cut(s) 258
BspMAI CTGCAG 1 cut(s) 301
BspTNI GGTCTC 1 cut(s) 271
BsrDI GCAATG 1 cut(s) 168
BssECI CCNNGG 1 cut(s) 318
BssMI GATC 1 cut(s) 307
BssSI CACGAG 1 cut(s) 189
Bst2BI CACGAG 1 cut(s) 189
Bst2UI CCWGG 2 cut(s) 86, 319
Bst4CI ACNGT 1 cut(s) 240
BstAPI GCANNNNNTGC 1 cut(s) 218
BstC8I GCNNGC 1 cut(s) 256
BstDEI CTNAG 2 cut(s) 66, 273
BstFNI CGCG 1 cut(s) 258
BstKTI GATC 1 cut(s) 310
BstMAI GTCTC 2 cut(s) 148, 271
BstMBI GATC 1 cut(s) 307
BstMWI GCNNNNNNNGC 2 cut(s) 88, 218
BstNI CCWGG 2 cut(s) 86, 319
BstSCI CCNGG 2 cut(s) 84, 317
BstSFI CTRYAG 1 cut(s) 297
BstUI CGCG 1 cut(s) 258
BtuMI TCGCGA 1 cut(s) 258
Cac8I GCNNGC 1 cut(s) 256
CviAII CATG 2 cut(s) 209, 289
CviJI RGCY 4 cut(s) 39, 91, 142, 188
CviKI_1 RGCY 4 cut(s) 39, 91, 142, 188
DdeI CTNAG 2 cut(s) 66, 273
DpnI GATC 1 cut(s) 309
DpnII GATC 1 cut(s) 307
Eco31I GGTCTC 1 cut(s) 271
EcoRII CCWGG 2 cut(s) 84, 317
EcoT22I ATGCAT 1 cut(s) 99
FaeI CATG 2 cut(s) 212, 292
FatI CATG 2 cut(s) 208, 288
FblI GTMKAC 1 cut(s) 235
FspBI CTAG 3 cut(s) 102, 176, 222
Hin1II CATG 2 cut(s) 212, 292
HincII GTYRAC 1 cut(s) 269
HindII GTYRAC 1 cut(s) 269
HinfI GANTC 1 cut(s) 49
Hpy166II GTNNAC 2 cut(s) 236, 269
Hpy188I TCNGA 2 cut(s) 67, 276
Hpy188III TCNNGA 3 cut(s) 191, 257, 313
Hpy8I GTNNAC 2 cut(s) 236, 269
HpyAV CCTTC 1 cut(s) 121
HpyCH4III ACNGT 1 cut(s) 240
HpyCH4V TGCA 7 cut(s) 82, 97, 110, 212, 248, 292, 299
HpyF10VI GCNNNNNNNGC 2 cut(s) 88, 218
HpyF3I CTNAG 2 cut(s) 66, 273
Hsp92II CATG 2 cut(s) 212, 292
Kzo9I GATC 1 cut(s) 307
LmnI GCTCC 1 cut(s) 88
LpnPI CCDG 6 cut(s) 71, 98, 143, 285, 304, 331
LweI GCATC 1 cut(s) 241
MaeI CTAG 3 cut(s) 102, 176, 222
MalI GATC 1 cut(s) 309
MboI GATC 1 cut(s) 307
MfeI CAATTG 1 cut(s) 111
MluCI AATT 2 cut(s) 111, 331
MnlI CCTC 1 cut(s) 282
Mph1103I ATGCAT 1 cut(s) 99
MseI TTAA 1 cut(s) 352
MspR9I CCNGG 2 cut(s) 86, 319
MunI CAATTG 1 cut(s) 111
MvaI CCWGG 2 cut(s) 86, 319
MvnI CGCG 1 cut(s) 258
MwoI GCNNNNNNNGC 2 cut(s) 88, 218
NdeII GATC 1 cut(s) 307
NlaIII CATG 2 cut(s) 212, 292
NruI TCGCGA 1 cut(s) 258
NsiI ATGCAT 1 cut(s) 99
PcsI WCGNNNNNNNCGW 1 cut(s) 262
PfeI GAWTC 1 cut(s) 49
Psp6I CCWGG 2 cut(s) 84, 317
PspGI CCWGG 2 cut(s) 84, 317
PstI CTGCAG 1 cut(s) 301
RruI TCGCGA 1 cut(s) 258
SaqAI TTAA 1 cut(s) 352
Sau3AI GATC 1 cut(s) 307
ScrFI CCNGG 2 cut(s) 86, 319
SetI ASST 6 cut(s) 41, 93, 144, 177, 274, 283
SfaNI GCATC 1 cut(s) 241
SfcI CTRYAG 1 cut(s) 297
Sse9I AATT 2 cut(s) 111, 331
SsiI CCGC 1 cut(s) 243
SspI AATATT 2 cut(s) 10, 136
SspMI CTAG 3 cut(s) 102, 176, 222
StyD4I CCNGG 2 cut(s) 84, 317
TaaI ACNGT 1 cut(s) 240
TasI AATT 2 cut(s) 111, 331
TfiI GAWTC 1 cut(s) 49
Tru1I TTAA 1 cut(s) 352
Tru9I TTAA 1 cut(s) 352
TspDTI ATGAA 2 cut(s) 135, 197
TspGWI ACGGA 1 cut(s) 254
XmiI GTMKAC 1 cut(s) 235
XspI CTAG 3 cut(s) 102, 176, 222
Zsp2I ATGCAT 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.