RchiOBHm_Chr2g0146461

FLX-like 3

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
64132934 .. 64134256
1323 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ51620

Sequence Viewer

Length: 252 bp
ATGAAAGCATGTCTTTTGAGCTATCAACAGATTCCTTTGCTAAAGTCTGAGATTGATGGTCTGCACCAGGAGCTTATGCATACTAGGAGTGCAATTGATTATGAAAAGAAGGCAAATATTGAGCTTATGGAACAGAGACAGGCAATGGAGAATAACCTAGTTTCTATGGCTCGTGAAGTTGAGAAACTTCATGCAGAACTTGCTAGAGTTGATGGTAGACCGTGGGGTGCAGGTAGTCTCCTATTTACGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

83

Amino Acids

9.5

Weight (kDa)

5.87

Isoelectric Point (pI)

49.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 221
AccI GTMKAC 1 cut(s) 217
AjnI CCWGG 1 cut(s) 66
AluBI AGCT 3 cut(s) 21, 73, 124
AluI AGCT 3 cut(s) 21, 73, 124
Alw26I GTCTC 2 cut(s) 130, 242
BauI CACGAG 1 cut(s) 171
BccI CCATC 2 cut(s) 50, 206
BciT130I CCWGG 1 cut(s) 68
BcoDI GTCTC 2 cut(s) 130, 242
BfaI CTAG 3 cut(s) 84, 158, 204
BfuAI ACCTGC 1 cut(s) 221
Bme1390I CCNGG 1 cut(s) 68
BmrFI CCNGG 1 cut(s) 68
BsaAI YACGTR 1 cut(s) 249
BsaJI CCNNGG 1 cut(s) 221
Bse3DI GCAATG 1 cut(s) 150
BseBI CCWGG 1 cut(s) 68
BseDI CCNNGG 1 cut(s) 221
BseMI GCAATG 1 cut(s) 150
BseMII CTCAG 1 cut(s) 39
BsgI GTGCAG 2 cut(s) 47, 249
BsmAI GTCTC 2 cut(s) 130, 242
BspCNI CTCAG 1 cut(s) 40
BspMI ACCTGC 1 cut(s) 221
BsrDI GCAATG 1 cut(s) 150
BssECI CCNNGG 1 cut(s) 221
BssSI CACGAG 1 cut(s) 171
Bst2BI CACGAG 1 cut(s) 171
Bst2UI CCWGG 1 cut(s) 68
Bst4CI ACNGT 1 cut(s) 222
BstAPI GCANNNNNTGC 1 cut(s) 200
BstBAI YACGTR 1 cut(s) 249
BstDEI CTNAG 1 cut(s) 48
BstDSI CCRYGG 1 cut(s) 221
BstMAI GTCTC 2 cut(s) 130, 242
BstMWI GCNNNNNNNGC 2 cut(s) 70, 200
BstNI CCWGG 1 cut(s) 68
BstNSI RCATGY 1 cut(s) 12
BstSCI CCNGG 1 cut(s) 66
BstSNI TACGTA 1 cut(s) 249
BtgI CCRYGG 1 cut(s) 221
BveI ACCTGC 1 cut(s) 221
CviAII CATG 2 cut(s) 9, 191
CviJI RGCY 4 cut(s) 21, 73, 124, 170
CviKI_1 RGCY 4 cut(s) 21, 73, 124, 170
DdeI CTNAG 1 cut(s) 48
Eco105I TACGTA 1 cut(s) 249
EcoRII CCWGG 1 cut(s) 66
EcoT22I ATGCAT 1 cut(s) 81
FaeI CATG 2 cut(s) 12, 194
FaiI YATR 7 cut(s) 10, 77, 81, 102, 128, 167, 192
FalI AAGNNNNNCTT 1 cut(s) 29
FatI CATG 2 cut(s) 8, 190
FblI GTMKAC 1 cut(s) 217
FspBI CTAG 3 cut(s) 84, 158, 204
Hin1II CATG 2 cut(s) 12, 194
HinfI GANTC 1 cut(s) 31
Hpy166II GTNNAC 1 cut(s) 218
Hpy188I TCNGA 1 cut(s) 49
Hpy188III TCNNGA 1 cut(s) 173
Hpy8I GTNNAC 1 cut(s) 218
HpyAV CCTTC 1 cut(s) 103
HpyCH4III ACNGT 1 cut(s) 222
HpyCH4IV ACGT 1 cut(s) 248
HpyCH4V TGCA 5 cut(s) 64, 79, 92, 194, 230
HpyF10VI GCNNNNNNNGC 2 cut(s) 70, 200
HpyF3I CTNAG 1 cut(s) 48
HpySE526I ACGT 1 cut(s) 248
Hsp92II CATG 2 cut(s) 12, 194
LmnI GCTCC 1 cut(s) 70
LpnPI CCDG 4 cut(s) 53, 80, 125, 216
MaeI CTAG 3 cut(s) 84, 158, 204
MaeII ACGT 1 cut(s) 248
MfeI CAATTG 1 cut(s) 93
MluCI AATT 1 cut(s) 93
Mph1103I ATGCAT 1 cut(s) 81
MspR9I CCNGG 1 cut(s) 68
MunI CAATTG 1 cut(s) 93
MvaI CCWGG 1 cut(s) 68
MwoI GCNNNNNNNGC 2 cut(s) 70, 200
NlaIII CATG 2 cut(s) 12, 194
NsiI ATGCAT 1 cut(s) 81
NspI RCATGY 1 cut(s) 12
PfeI GAWTC 1 cut(s) 31
Ppu21I YACGTR 1 cut(s) 249
Psp6I CCWGG 1 cut(s) 66
PspGI CCWGG 1 cut(s) 66
ScrFI CCNGG 1 cut(s) 68
SetI ASST 6 cut(s) 23, 75, 126, 159, 235, 251
SnaBI TACGTA 1 cut(s) 249
Sse9I AATT 1 cut(s) 93
SspI AATATT 1 cut(s) 118
SspMI CTAG 3 cut(s) 84, 158, 204
StyD4I CCNGG 1 cut(s) 66
TaaI ACNGT 1 cut(s) 222
TaiI ACGT 1 cut(s) 251
TasI AATT 1 cut(s) 93
TfiI GAWTC 1 cut(s) 31
TspDTI ATGAA 3 cut(s) 17, 117, 179
XceI RCATGY 1 cut(s) 12
XmiI GTMKAC 1 cut(s) 217
XspI CTAG 3 cut(s) 84, 158, 204
Zsp2I ATGCAT 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.