RchiOBHm_Chr7g0199571

FLX-like 3

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
17656919 .. 17658888
1970 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ17859

Sequence Viewer

Length: 135 bp
ATGGTGATAGTGAAGAGACAGGCAATGGAGAATAACCTAGTTTCTATGGCTCGTGAAGTTGAGAAACTTCGTGCAGAACTTGCTAGAGTTGATGGTAGACCGTGGGGTGCAGGGCAACCAAGGAATAGAGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

44

Amino Acids

5.06

Weight (kDa)

10.7

Isoelectric Point (pI)

25.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 97
Alw26I GTCTC 1 cut(s) 10
AsuHPI GGTGA 1 cut(s) 16
BauI CACGAG 1 cut(s) 51
BccI CCATC 1 cut(s) 86
BcoDI GTCTC 1 cut(s) 10
BfaI CTAG 2 cut(s) 38, 84
BsaJI CCNNGG 2 cut(s) 101, 119
Bse3DI GCAATG 1 cut(s) 30
BseDI CCNNGG 2 cut(s) 101, 119
BseMI GCAATG 1 cut(s) 30
BsgI GTGCAG 2 cut(s) 93, 129
BsmAI GTCTC 1 cut(s) 10
BsrDI GCAATG 1 cut(s) 30
BssECI CCNNGG 2 cut(s) 101, 119
BssSI CACGAG 1 cut(s) 51
BssT1I CCWWGG 1 cut(s) 119
Bst2BI CACGAG 1 cut(s) 51
Bst4CI ACNGT 1 cut(s) 102
Bst6I CTCTTC 1 cut(s) 8
BstAPI GCANNNNNTGC 1 cut(s) 80
BstDSI CCRYGG 1 cut(s) 101
BstMAI GTCTC 1 cut(s) 10
BstMWI GCNNNNNNNGC 1 cut(s) 80
BtgI CCRYGG 1 cut(s) 101
CviJI RGCY 1 cut(s) 50
CviKI_1 RGCY 1 cut(s) 50
Eam1104I CTCTTC 1 cut(s) 8
EarI CTCTTC 1 cut(s) 8
Eco130I CCWWGG 1 cut(s) 119
EcoT14I CCWWGG 1 cut(s) 119
ErhI CCWWGG 1 cut(s) 119
FaiI YATR 1 cut(s) 47
FblI GTMKAC 1 cut(s) 97
FspBI CTAG 2 cut(s) 38, 84
HphI GGTGA 1 cut(s) 16
Hpy166II GTNNAC 1 cut(s) 98
Hpy188III TCNNGA 1 cut(s) 53
Hpy8I GTNNAC 1 cut(s) 98
HpyCH4III ACNGT 1 cut(s) 102
HpyCH4V TGCA 2 cut(s) 74, 110
HpyF10VI GCNNNNNNNGC 1 cut(s) 80
LpnPI CCDG 2 cut(s) 5, 96
MaeI CTAG 2 cut(s) 38, 84
MboII GAAGA 1 cut(s) 25
MwoI GCNNNNNNNGC 1 cut(s) 80
SetI ASST 1 cut(s) 39
SgeI CNNG 9 cut(s) 32, 50, 63, 65, 83, 92, 96, 114, 123
SspMI CTAG 2 cut(s) 38, 84
StyI CCWWGG 1 cut(s) 119
TaaI ACNGT 1 cut(s) 102
XmiI GTMKAC 1 cut(s) 97
XspI CTAG 2 cut(s) 38, 84
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.