Rh7DG182900

FLX-like 3

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0003143
Physical Location & Seq
Reverse (-)
17008089 .. 17009152
1064 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG182900.1

Sequence Viewer

Length: 357 bp
ATGGCCTATTCACTGAAATTTAGCTTGATGATCGAATCTGATAATCAACAGATTCCTTTTCTAAAGTCTGAGATTGATGGTCTGCACCAGGAGCTTATGCATGCTAGAAGTGTAATTGATTATGAAAAGAAGGCAAATATTGAGCTTATGGAACAGAGACAGGCAATGGAGAATAACCTAGTTTCTATGGCTCGTGAAGTTGAGAAACTTCGTGCAGAACTTGCTAGAGTTGATGGTAGACCGTGGGGTGCAGATGCTCGCGAAGTCCGTCAACCTCAGAGACCTAAACCCATGCAATCTGCAGGGAGTGATCTCTTGACCAGGGAAGCATATAATTTAAGTATTCCAACTCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

118

Amino Acids

13.6

Weight (kDa)

5.92

Isoelectric Point (pI)

48.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 238
AccII CGCG 1 cut(s) 261
AcsI RAATTY 1 cut(s) 17
AjnI CCWGG 2 cut(s) 87, 320
AluBI AGCT 3 cut(s) 24, 94, 145
AluI AGCT 3 cut(s) 24, 94, 145
Alw26I GTCTC 2 cut(s) 151, 274
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 1 cut(s) 17
BauI CACGAG 1 cut(s) 192
BccI CCATC 2 cut(s) 71, 227
BciT130I CCWGG 2 cut(s) 89, 322
BcoDI GTCTC 2 cut(s) 151, 274
BfaI CTAG 3 cut(s) 105, 179, 225
BfmI CTRYAG 1 cut(s) 300
Bme1390I CCNGG 2 cut(s) 89, 322
BmrFI CCNGG 2 cut(s) 89, 322
BmsI GCATC 1 cut(s) 244
BsaI GGTCTC 1 cut(s) 274
BsaJI CCNNGG 2 cut(s) 242, 321
Bse3DI GCAATG 1 cut(s) 171
BseBI CCWGG 2 cut(s) 89, 322
BseDI CCNNGG 2 cut(s) 242, 321
BseMI GCAATG 1 cut(s) 171
BseMII CTCAG 2 cut(s) 60, 290
BsgI GTGCAG 3 cut(s) 68, 234, 270
Bsh1236I CGCG 1 cut(s) 261
BshFI GGCC 1 cut(s) 5
BsmAI GTCTC 2 cut(s) 151, 274
BsnI GGCC 1 cut(s) 5
Bso31I GGTCTC 1 cut(s) 274
Bsp143I GATC 2 cut(s) 30, 310
Bsp68I TCGCGA 1 cut(s) 261
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 2 cut(s) 61, 289
BspFNI CGCG 1 cut(s) 261
BspMAI CTGCAG 1 cut(s) 304
BspTNI GGTCTC 1 cut(s) 274
BsrDI GCAATG 1 cut(s) 171
BssECI CCNNGG 2 cut(s) 242, 321
BssMI GATC 2 cut(s) 30, 310
BssSI CACGAG 1 cut(s) 192
Bst2BI CACGAG 1 cut(s) 192
Bst2UI CCWGG 2 cut(s) 89, 322
Bst4CI ACNGT 1 cut(s) 243
BstAPI GCANNNNNTGC 1 cut(s) 221
BstC8I GCNNGC 2 cut(s) 102, 259
BstDEI CTNAG 2 cut(s) 69, 276
BstDSI CCRYGG 1 cut(s) 242
BstFNI CGCG 1 cut(s) 261
BstKTI GATC 2 cut(s) 33, 313
BstMAI GTCTC 2 cut(s) 151, 274
BstMBI GATC 2 cut(s) 30, 310
BstMWI GCNNNNNNNGC 2 cut(s) 91, 221
BstNI CCWGG 2 cut(s) 89, 322
BstNSI RCATGY 1 cut(s) 104
BstSCI CCNGG 2 cut(s) 87, 320
BstSFI CTRYAG 1 cut(s) 300
BstUI CGCG 1 cut(s) 261
BsuRI GGCC 1 cut(s) 5
BtgI CCRYGG 1 cut(s) 242
BtsIMutI CAGTG 1 cut(s) 11
BtuMI TCGCGA 1 cut(s) 261
Cac8I GCNNGC 2 cut(s) 102, 259
CviAII CATG 2 cut(s) 101, 292
CviJI RGCY 5 cut(s) 5, 24, 94, 145, 191
CviKI_1 RGCY 5 cut(s) 5, 24, 94, 145, 191
DdeI CTNAG 2 cut(s) 69, 276
DpnI GATC 2 cut(s) 32, 312
DpnII GATC 2 cut(s) 30, 310
Eco31I GGTCTC 1 cut(s) 274
EcoRII CCWGG 2 cut(s) 87, 320
EcoT22I ATGCAT 1 cut(s) 102
FaeI CATG 2 cut(s) 104, 295
FaiI YATR 8 cut(s) 98, 102, 123, 149, 188, 293, 331, 333
FatI CATG 2 cut(s) 100, 291
FblI GTMKAC 1 cut(s) 238
FspBI CTAG 3 cut(s) 105, 179, 225
HaeIII GGCC 1 cut(s) 5
Hin1II CATG 2 cut(s) 104, 295
HincII GTYRAC 1 cut(s) 272
HindII GTYRAC 1 cut(s) 272
HinfI GANTC 2 cut(s) 35, 52
Hpy166II GTNNAC 2 cut(s) 239, 272
Hpy188I TCNGA 3 cut(s) 40, 70, 279
Hpy188III TCNNGA 3 cut(s) 194, 260, 316
Hpy8I GTNNAC 2 cut(s) 239, 272
HpyAV CCTTC 1 cut(s) 124
HpyCH4III ACNGT 1 cut(s) 243
HpyCH4V TGCA 6 cut(s) 85, 100, 215, 251, 295, 302
HpyF10VI GCNNNNNNNGC 2 cut(s) 91, 221
HpyF3I CTNAG 2 cut(s) 69, 276
Hsp92II CATG 2 cut(s) 104, 295
Kzo9I GATC 2 cut(s) 30, 310
LmnI GCTCC 1 cut(s) 91
LpnPI CCDG 6 cut(s) 74, 101, 146, 288, 307, 334
LweI GCATC 1 cut(s) 244
MaeI CTAG 3 cut(s) 105, 179, 225
MalI GATC 2 cut(s) 32, 312
MboI GATC 2 cut(s) 30, 310
MluCI AATT 3 cut(s) 17, 114, 334
MnlI CCTC 1 cut(s) 285
Mph1103I ATGCAT 1 cut(s) 102
MseI TTAA 2 cut(s) 338, 355
MspR9I CCNGG 2 cut(s) 89, 322
MvaI CCWGG 2 cut(s) 89, 322
MvnI CGCG 1 cut(s) 261
MwoI GCNNNNNNNGC 2 cut(s) 91, 221
NdeII GATC 2 cut(s) 30, 310
NlaIII CATG 2 cut(s) 104, 295
NruI TCGCGA 1 cut(s) 261
NsiI ATGCAT 1 cut(s) 102
NspI RCATGY 1 cut(s) 104
PaeI GCATGC 1 cut(s) 104
PcsI WCGNNNNNNNCGW 1 cut(s) 265
PfeI GAWTC 2 cut(s) 35, 52
Psp6I CCWGG 2 cut(s) 87, 320
PspGI CCWGG 2 cut(s) 87, 320
PstI CTGCAG 1 cut(s) 304
RruI TCGCGA 1 cut(s) 261
SaqAI TTAA 2 cut(s) 338, 355
Sau3AI GATC 2 cut(s) 30, 310
ScrFI CCNGG 2 cut(s) 89, 322
SetI ASST 6 cut(s) 26, 96, 147, 180, 277, 286
SfaNI GCATC 1 cut(s) 244
SfcI CTRYAG 1 cut(s) 300
SphI GCATGC 1 cut(s) 104
Sse9I AATT 3 cut(s) 17, 114, 334
SspI AATATT 1 cut(s) 139
SspMI CTAG 3 cut(s) 105, 179, 225
StyD4I CCNGG 2 cut(s) 87, 320
TaaI ACNGT 1 cut(s) 243
TaqI TCGA 1 cut(s) 33
TasI AATT 3 cut(s) 17, 114, 334
TfiI GAWTC 2 cut(s) 35, 52
Tru1I TTAA 2 cut(s) 338, 355
Tru9I TTAA 2 cut(s) 338, 355
TscAI CASTG 1 cut(s) 18
TspDTI ATGAA 1 cut(s) 138
TspGWI ACGGA 1 cut(s) 257
TspRI CASTG 1 cut(s) 18
XapI RAATTY 1 cut(s) 17
XceI RCATGY 1 cut(s) 104
XmiI GTMKAC 1 cut(s) 238
XspI CTAG 3 cut(s) 105, 179, 225
Zsp2I ATGCAT 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.