pycom12g04000

Carboxylesterase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Reverse (-)
3927391 .. 3929014
1624 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 291 bp
ATGCCAGTAGGAGAAACCAGAGACCATCCAATGGTCAACCCATTTGGACCAAACAGTCCAAACCTTGAGAAGGTGGCCCTTGATCCCATCTTGGTTATCGTGGGTGGCAATGAACTGTTGAAAGATAGGGTGGAGAGCTACTGGAGAAAGTTAAAAGATTTGGGAAAGAAAATTGAGTATGTCGAATTTAAAGGAGAGCAACATGGTTTTTTAACTAATGATCGATACTCAGAAGTCTCAAATGAAGCTTTGGTGTTATCATCGTACAAGTCTTATCATTTTAAATTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

97

Amino Acids

11.02

Weight (kDa)

6.28

Isoelectric Point (pI)

16.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Abhydrolase_3 PF07859 4 - 71 2.5e-12 alpha/beta hydrolase fold
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 289
AasI GACNNNNNNGTC 1 cut(s) 54
AccB7I CCANNNNNTGG 1 cut(s) 31
AclWI GGATC 1 cut(s) 77
AcsI RAATTY 1 cut(s) 185
AfaI GTAC 1 cut(s) 266
AfiI CCNNNNNNNGG 2 cut(s) 31, 70
AgsI TTSAA 1 cut(s) 121
AluBI AGCT 2 cut(s) 138, 248
AluI AGCT 2 cut(s) 138, 248
Alw26I GTCTC 2 cut(s) 15, 241
AlwI GGATC 1 cut(s) 77
AoxI GGCC 1 cut(s) 75
ApoI RAATTY 1 cut(s) 185
AspS9I GGNCC 2 cut(s) 47, 76
AvaII GGWCC 1 cut(s) 47
BccI CCATC 2 cut(s) 33, 95
BcoDI GTCTC 2 cut(s) 15, 241
Bme18I GGWCC 1 cut(s) 47
BmgT120I GGNCC 2 cut(s) 47, 76
BpmI CTGGAG 1 cut(s) 163
BpuEI CTTGAG 1 cut(s) 86
Bsa29I ATCGAT 1 cut(s) 223
BsaI GGTCTC 1 cut(s) 15
Bsc4I CCNNNNNNNGG 2 cut(s) 31, 70
Bse1I ACTGG 2 cut(s) 5, 146
Bse3DI GCAATG 1 cut(s) 115
BseCI ATCGAT 1 cut(s) 223
BseGI GGATG 1 cut(s) 25
BseLI CCNNNNNNNGG 2 cut(s) 31, 70
BseMI GCAATG 1 cut(s) 115
BseMII CTCAG 1 cut(s) 243
BseNI ACTGG 2 cut(s) 5, 146
BshFI GGCC 1 cut(s) 77
BshVI ATCGAT 1 cut(s) 223
BslI CCNNNNNNNGG 2 cut(s) 31, 70
BsmAI GTCTC 2 cut(s) 15, 241
BsnI GGCC 1 cut(s) 77
Bso31I GGTCTC 1 cut(s) 15
Bsp143I GATC 2 cut(s) 82, 220
BspANI GGCC 1 cut(s) 77
BspCNI CTCAG 1 cut(s) 242
BspDI ATCGAT 1 cut(s) 223
BspPI GGATC 1 cut(s) 77
BspTNI GGTCTC 1 cut(s) 15
BsrDI GCAATG 1 cut(s) 115
BsrI ACTGG 2 cut(s) 5, 146
BssMI GATC 2 cut(s) 82, 220
Bst4CI ACNGT 2 cut(s) 56, 117
BstDEI CTNAG 1 cut(s) 229
BstENI CCTNNNNNAGG 1 cut(s) 68
BstF5I GGATG 1 cut(s) 25
BstKTI GATC 2 cut(s) 85, 223
BstMAI GTCTC 2 cut(s) 15, 241
BstMBI GATC 2 cut(s) 82, 220
Bsu15I ATCGAT 1 cut(s) 223
BsuRI GGCC 1 cut(s) 77
BsuTUI ATCGAT 1 cut(s) 223
BtsCI GGATG 1 cut(s) 25
Cfr13I GGNCC 2 cut(s) 47, 76
ClaI ATCGAT 1 cut(s) 223
Csp6I GTAC 1 cut(s) 265
CviAII CATG 1 cut(s) 203
CviJI RGCY 3 cut(s) 77, 138, 248
CviKI_1 RGCY 3 cut(s) 77, 138, 248
CviQI GTAC 1 cut(s) 265
DdeI CTNAG 1 cut(s) 229
DpnI GATC 2 cut(s) 84, 222
DpnII GATC 2 cut(s) 82, 220
DraI TTTAAA 2 cut(s) 190, 283
DrdI GACNNNNNNGTC 1 cut(s) 54
DseDI GACNNNNNNGTC 1 cut(s) 54
Eco31I GGTCTC 1 cut(s) 15
Eco47I GGWCC 1 cut(s) 47
EcoNI CCTNNNNNAGG 1 cut(s) 68
FaeI CATG 1 cut(s) 206
FaiI YATR 3 cut(s) 180, 204, 289
FatI CATG 1 cut(s) 202
FokI GGATG 1 cut(s) 12
GsuI CTGGAG 1 cut(s) 163
HaeIII GGCC 1 cut(s) 77
Hin1II CATG 1 cut(s) 206
HincII GTYRAC 1 cut(s) 37
HindII GTYRAC 1 cut(s) 37
HindIII AAGCTT 1 cut(s) 246
Hpy166II GTNNAC 1 cut(s) 37
Hpy188I TCNGA 1 cut(s) 232
Hpy8I GTNNAC 1 cut(s) 37
HpyAV CCTTC 1 cut(s) 64
HpyCH4III ACNGT 2 cut(s) 56, 117
HpyF3I CTNAG 1 cut(s) 229
Hsp92II CATG 1 cut(s) 206
Kzo9I GATC 2 cut(s) 82, 220
LpnPI CCDG 3 cut(s) 18, 31, 127
MalI GATC 2 cut(s) 84, 222
MboI GATC 2 cut(s) 82, 220
MluCI AATT 3 cut(s) 171, 185, 284
MseI TTAA 4 cut(s) 152, 189, 212, 282
NdeII GATC 2 cut(s) 82, 220
NlaIII CATG 1 cut(s) 206
PflMI CCANNNNNTGG 1 cut(s) 31
PsiI TTATAA 1 cut(s) 289
PspPI GGNCC 2 cut(s) 47, 76
RsaI GTAC 1 cut(s) 266
RsaNI GTAC 1 cut(s) 265
SaqAI TTAA 4 cut(s) 152, 189, 212, 282
Sau3AI GATC 2 cut(s) 82, 220
Sau96I GGNCC 2 cut(s) 47, 76
SetI ASST 4 cut(s) 66, 75, 140, 250
SgeI CNNG 9 cut(s) 17, 30, 77, 92, 103, 112, 154, 215, 280
SinI GGWCC 1 cut(s) 47
SmlI CTYRAG 1 cut(s) 65
SmoI CTYRAG 1 cut(s) 65
Sse9I AATT 3 cut(s) 171, 185, 284
TaaI ACNGT 2 cut(s) 56, 117
TaqI TCGA 2 cut(s) 183, 223
TasI AATT 3 cut(s) 171, 185, 284
Tru1I TTAA 4 cut(s) 152, 189, 212, 282
Tru9I TTAA 4 cut(s) 152, 189, 212, 282
TspDTI ATGAA 2 cut(s) 126, 258
Van91I CCANNNNNTGG 1 cut(s) 31
VpaK11BI GGWCC 1 cut(s) 47
XagI CCTNNNNNAGG 1 cut(s) 68
XapI RAATTY 1 cut(s) 185
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.