pycom12g05030

NB-ARC domain

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Forward (+)
4931172 .. 4931579
408 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 408 bp
ATGTGTTGGGTATACTTTCTCAGAAACAAATCTGATACCTTCAATGTGTTCAAAAAATTCAAAGCTTTTGTTGAACTGCAAAGTGGGTTCAGTTTAAAGAAGCTAAGGAGTGATAGAGGTGGTGAATACACCTCACATGAGTTTCTAGATTACTGTGCAAGCATGGGAATGGAGAGGCAACTGACTATTGCCTACTCTCCTCAGCAAAATGGAGTTGCTGAGAGGAAGAATAGATCAATTGGTGAGATGGCAAGGTCCATGATGGTTGAGAAAGAAATTCATGTAGTCTTCTGGGCAGAAGCTGTAAGCACATCTGTGTATCTTCAAAATAGATGTTTTACAACATCTGTTCTAGATAAAACTCCTTTTGAAGCATTCACAAGTAGGAAGCCTGGATCAAGCATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

136

Amino Acids

15.57

Weight (kDa)

9.22

Isoelectric Point (pI)

39.04

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
rve PF00665 2 - 67 1.3e-07 Integrase core domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 12
AclWI GGATC 1 cut(s) 403
AcsI RAATTY 2 cut(s) 56, 276
AgsI TTSAA 6 cut(s) 43, 52, 61, 74, 326, 371
AjnI CCWGG 1 cut(s) 391
AleI CACNNNNGTG 1 cut(s) 314
AluBI AGCT 3 cut(s) 65, 103, 302
AluI AGCT 3 cut(s) 65, 103, 302
AlwI GGATC 1 cut(s) 403
AlwNI CAGNNNCTG 1 cut(s) 302
ApoI RAATTY 2 cut(s) 56, 276
AspS9I GGNCC 1 cut(s) 255
AsuHPI GGTGA 2 cut(s) 134, 254
AvaII GGWCC 1 cut(s) 255
BbsI GAAGAC 1 cut(s) 280
BbvCI CCTCAGC 1 cut(s) 201
BccI CCATC 2 cut(s) 241, 256
BciT130I CCWGG 1 cut(s) 393
BfaI CTAG 2 cut(s) 146, 353
Bme1390I CCNGG 1 cut(s) 393
Bme18I GGWCC 1 cut(s) 255
BmgT120I GGNCC 1 cut(s) 255
BmrFI CCNGG 1 cut(s) 393
BpiI GAAGAC 1 cut(s) 280
Bpu10I CCTNAGC 2 cut(s) 104, 201
BseBI CCWGG 1 cut(s) 393
BseMII CTCAG 3 cut(s) 34, 210, 215
BseRI GAGGAG 1 cut(s) 189
BsmI GAATGC 1 cut(s) 374
Bsp143I GATC 2 cut(s) 233, 395
BspCNI CTCAG 3 cut(s) 33, 211, 214
BspPI GGATC 1 cut(s) 403
BssMI GATC 2 cut(s) 233, 395
BssNAI GTATAC 1 cut(s) 13
Bst1107I GTATAC 1 cut(s) 13
Bst2UI CCWGG 1 cut(s) 393
Bst4CI ACNGT 1 cut(s) 155
BstC8I GCNNGC 1 cut(s) 160
BstDEI CTNAG 4 cut(s) 20, 104, 201, 219
BstKTI GATC 2 cut(s) 236, 398
BstMBI GATC 2 cut(s) 233, 395
BstNI CCWGG 1 cut(s) 393
BstSCI CCNGG 1 cut(s) 391
BstV2I GAAGAC 1 cut(s) 280
BstZ17I GTATAC 1 cut(s) 13
Cac8I GCNNGC 1 cut(s) 160
CaiI CAGNNNCTG 1 cut(s) 302
Cfr13I GGNCC 1 cut(s) 255
CviAII CATG 4 cut(s) 137, 163, 259, 281
CviJI RGCY 4 cut(s) 65, 103, 302, 391
CviKI_1 RGCY 4 cut(s) 65, 103, 302, 391
DdeI CTNAG 4 cut(s) 20, 104, 201, 219
DpnI GATC 2 cut(s) 235, 397
DpnII GATC 2 cut(s) 233, 395
DraI TTTAAA 1 cut(s) 96
Eco47I GGWCC 1 cut(s) 255
EcoRII CCWGG 1 cut(s) 391
FaeI CATG 4 cut(s) 140, 166, 262, 284
FaiI YATR 5 cut(s) 13, 138, 164, 260, 282
FatI CATG 4 cut(s) 136, 162, 258, 280
FblI GTMKAC 1 cut(s) 12
FspBI CTAG 2 cut(s) 146, 353
Hin1II CATG 4 cut(s) 140, 166, 262, 284
HindIII AAGCTT 1 cut(s) 63
HphI GGTGA 2 cut(s) 134, 254
Hpy166II GTNNAC 1 cut(s) 13
Hpy188I TCNGA 3 cut(s) 23, 34, 407
Hpy188III TCNNGA 2 cut(s) 146, 353
Hpy8I GTNNAC 1 cut(s) 13
HpyAV CCTTC 1 cut(s) 49
HpyCH4III ACNGT 1 cut(s) 155
HpyCH4V TGCA 2 cut(s) 79, 158
HpyF3I CTNAG 4 cut(s) 20, 104, 201, 219
Hsp92II CATG 4 cut(s) 140, 166, 262, 284
Kzo9I GATC 2 cut(s) 233, 395
LpnPI CCDG 2 cut(s) 277, 378
MaeI CTAG 2 cut(s) 146, 353
MalI GATC 2 cut(s) 235, 397
MboI GATC 2 cut(s) 233, 395
MboII GAAGA 3 cut(s) 238, 280, 314
MfeI CAATTG 1 cut(s) 237
MluCI AATT 3 cut(s) 56, 237, 276
MnlI CCTC 5 cut(s) 110, 142, 168, 210, 216
MseI TTAA 1 cut(s) 95
MslI CAYNNNNRTG 2 cut(s) 167, 314
MspR9I CCNGG 1 cut(s) 393
MunI CAATTG 1 cut(s) 237
Mva1269I GAATGC 1 cut(s) 374
MvaI CCWGG 1 cut(s) 393
NdeII GATC 2 cut(s) 233, 395
NlaIII CATG 4 cut(s) 140, 166, 262, 284
OliI CACNNNNGTG 1 cut(s) 314
PctI GAATGC 1 cut(s) 374
Psp6I CCWGG 1 cut(s) 391
PspGI CCWGG 1 cut(s) 391
PspPI GGNCC 1 cut(s) 255
PstNI CAGNNNCTG 1 cut(s) 302
RseI CAYNNNNRTG 2 cut(s) 167, 314
SaqAI TTAA 1 cut(s) 95
Sau3AI GATC 2 cut(s) 233, 395
Sau96I GGNCC 1 cut(s) 255
ScrFI CCNGG 1 cut(s) 393
SetI ASST 7 cut(s) 41, 67, 105, 121, 134, 257, 304
SinI GGWCC 1 cut(s) 255
SmiMI CAYNNNNRTG 2 cut(s) 167, 314
Sse9I AATT 3 cut(s) 56, 237, 276
SspMI CTAG 2 cut(s) 146, 353
StyD4I CCNGG 1 cut(s) 391
TaaI ACNGT 1 cut(s) 155
TasI AATT 3 cut(s) 56, 237, 276
Tru1I TTAA 1 cut(s) 95
Tru9I TTAA 1 cut(s) 95
TspDTI ATGAA 1 cut(s) 269
VpaK11BI GGWCC 1 cut(s) 255
XapI RAATTY 2 cut(s) 56, 276
XbaI TCTAGA 2 cut(s) 145, 352
XmiI GTMKAC 1 cut(s) 12
XspI CTAG 2 cut(s) 146, 353
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.