Rorug04G0109300

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Forward (+)
17109279 .. 17109446
168 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0109300.1

Sequence Viewer

Length: 168 bp
ATGGAGAAGGATACAGTTGAACGAGCTACTGAACCAACCCTGAATTTGTTTGCCTATCTTAAGGATGCCTATGTACATCCTGACTTCAAGGGAGGGGAGATGTACAAAACTGAAGCCATTTACGAAGAAGAGAGAAATCCTCTTGTTCCTACAAAGAGGGACAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.47

Weight (kDa)

4.81

Isoelectric Point (pI)

35.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 43
AcuI CTGAAG 1 cut(s) 132
AfaI GTAC 2 cut(s) 75, 104
AflII CTTAAG 1 cut(s) 59
AgsI TTSAA 2 cut(s) 20, 88
AluBI AGCT 1 cut(s) 26
AluI AGCT 1 cut(s) 26
ApoI RAATTY 1 cut(s) 43
BciVI GTATCC 1 cut(s) 4
BfrI CTTAAG 1 cut(s) 59
BfuI GTATCC 1 cut(s) 4
BmsI GCATC 1 cut(s) 55
BplI GAGNNNNNCTC 2 cut(s) 124, 156
BseGI GGATG 2 cut(s) 70, 76
Bsp1407I TGTACA 2 cut(s) 73, 102
BspTI CTTAAG 1 cut(s) 59
BsrGI TGTACA 2 cut(s) 73, 102
Bst4CI ACNGT 1 cut(s) 16
Bst6I CTCTTC 1 cut(s) 123
BstAFI CTTAAG 1 cut(s) 59
BstAUI TGTACA 2 cut(s) 73, 102
BstF5I GGATG 2 cut(s) 70, 76
BsuI GTATCC 1 cut(s) 4
BtsCI GGATG 2 cut(s) 70, 76
Csp6I GTAC 2 cut(s) 74, 103
CviJI RGCY 2 cut(s) 26, 116
CviKI_1 RGCY 2 cut(s) 26, 116
CviQI GTAC 2 cut(s) 74, 103
Eam1104I CTCTTC 1 cut(s) 123
EarI CTCTTC 1 cut(s) 123
Eco57I CTGAAG 1 cut(s) 132
FaiI YATR 1 cut(s) 72
FokI GGATG 2 cut(s) 63, 77
Hpy188III TCNNGA 1 cut(s) 80
HpyCH4III ACNGT 1 cut(s) 16
LpnPI CCDG 2 cut(s) 53, 93
LweI GCATC 1 cut(s) 55
MboII GAAGA 2 cut(s) 137, 140
MluCI AATT 1 cut(s) 43
MnlI CCTC 3 cut(s) 86, 150, 150
MseI TTAA 1 cut(s) 60
MspCI CTTAAG 1 cut(s) 59
RsaI GTAC 2 cut(s) 75, 104
RsaNI GTAC 2 cut(s) 74, 103
SaqAI TTAA 1 cut(s) 60
SetI ASST 1 cut(s) 28
SfaNI GCATC 1 cut(s) 55
SgeI CNNG 5 cut(s) 35, 52, 92, 100, 155
SmlI CTYRAG 1 cut(s) 59
SmoI CTYRAG 1 cut(s) 59
Sse9I AATT 1 cut(s) 43
TaaI ACNGT 1 cut(s) 16
TasI AATT 1 cut(s) 43
TatI WGTACW 2 cut(s) 73, 102
Tru1I TTAA 1 cut(s) 60
Tru9I TTAA 1 cut(s) 60
Vha464I CTTAAG 1 cut(s) 59
XapI RAATTY 1 cut(s) 43
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.